Будьте всегда 120 на 70!

Содержание

Клебсиелла в кале у грудничка: опасность, симптомы и лечение

Только при рождении организм малыша начинает заполняться необходимыми микроорганизмами и бактериями, которые в дальнейшем помогают правильно работать всем системам и формируют надежную защиту иммунитета.

Одной из первых заселяется клебсиелла, так как находится практически во всем, что нас окружает. Данная бактерия относится к условно патогенным микроорганизмам, поэтому, когда иммунитет в порядке, то в организме поддерживается оптимальное соотношение полезных и патогенных бактерий.

Однако, любой сбой приводит к тому, что количество патогенных бактерий начинает размножаться и тем самым вызывает определенные нарушения в работе той или иной системы.

Сегодня я предлагаю выяснить, о чем говорит найденная клебсиелла в моче, кишечнике и, соответственно, в кале у грудничка. Давайте разбираться!

Что это такое

Клебсиелла – грамотрицательная палочковидная бактерия. Она способна существовать и размножаться как без доступа кислорода, так и в его присутствии. Она имеет мембрану, которая защищает ее от действия агрессивной среды и антибиотиков. Стоит отметить, что часто при попадании в организм малыша клебсиеллы, родителями не замечаются какие-то нарушения в его жизнедеятельности.

При этом, действительно данная бактерия может достаточно долго существовать в организме маленького человечка, и вы ничего не будете подозревать. В данном случае ни лечить, ни как-то бороться с ней не требуется.

Однако, если иммунитет грудничка ослабевает или происходят другие явления, которые стимулируют ее рост и размножение, то в этом случае требуется немедленное вмешательство врачей.

Давайте узнаем, что может стать причиной инфицирования и, как следствие, появления повышенного количества бактерий в кале ребенка.

Причины появления клебсиеллы в кале малыша

Начать активный процесс размножения и, соответственно, показывать увеличенные показатели в анализах кала или других забранных биоматериалах клебсиелла может по нескольким причинам. Все факторы принято условно объединять в две большие категории: внутренние причины и внешние.

Внешние причины

  • Контакт ребенка со взрослым, который является инфицированным.
  • Кормление зараженными продуктами.
  • Распространение клебсиеллы через грязные игрушки, посуду, животных. Очень важно соблюдать правила гигиены в уходе за ребенком. Ни в коем случае не разрешается трогать грудничка людям, которые пришли с улицы и не помыли руки, не разрешается также давать грязные продукты питания или не помытые после покупки игрушки. Разумеется, не стоит мыть книги и какие-либо бумажные изделия, а вот пластиковые и мягкие игрушки просто необходимо обрабатывать перед тем, как они попадут в руки или в рот к грудничку.

Внутренние причины

  • Ослабленный иммунитет.
  • Дисбаланс микрофлоры в кишечнике.
  • Нехватка полезных бактерий из-за проведенной антибактериальной терапии.
  • Наличие других патогенных микроорганизмов в кишечнике, которые могут нарушать здоровую микрофлору.
  • Пищевая аллергия у ребенка.

Малыш рождается с очень слабым иммунитетом, поэтому заражение может произойти как во время родов, так и в первое время после них. Для того, чтобы избежать данной неприятности, необходимо во время беременности максимально защищать себя и плод от заражения различными инфекциями, употреблять достаточное количество витаминов и минералов.

Виды клебсиеллезных поражений

В медицине принято выделять 7 видов этой бактерии, однако наиболее часто встречаемыми в анализах кала и опасными для грудничка являются только два вида:

  • клебсиелла окситока;
  • пневмония.

Наиболее редкими клебсиеллезными поражениями считаются: сепсис, заболевания мочеполовой системы, инфицирование мозговых оболочек, поражение костей или суставов, клебсиеллезный конъюнктивит.

Симптомы болезни у детей до года

Диагностировать заболевание в домашних условиях достаточно тяжело. Нередко симптомы, которые свидетельствуют о наличии клебсиеллы в кале и в целом – в организме малыша, очень схожи с признаками отравления или дисбактериоза, которые являются частыми заболеваниями в жизни новорожденного. Но все же к симптомам клебсиеллы принято относить:

Эти симптомы характерны для группы клебсиелла окситока, что же касается клебсиеллы пневмонии, то тут симптомы очень схожи с признаками гриппа или ОРВИ. К ним можно отнести:

  • Резкое повышение температуры до 39, а то и выше градусов.
  • Затрудненное дыхание и лихорадка.
  • Лающий кашель у ребенка в начале недуга.
  • На более поздних этапах появляется кашель с выделениями мокроты, в которой могут отмечаться прожилки крови.

Если вы видите у грудничка хотя бы несколько симптомов, то стоит немедленно обратиться к педиатру. Врач сможет назначить необходимые анализы: исследование кала и других биоматериалов, а также другие обследования на наличие патогенных бактерий в организме крохи.

Чем опасна клебиелла в кале для крохи

В случаях, когда иммунитет грудничка в состоянии побороть атаку и размножение клебсиеллы, то тогда возможно появление лишь инфекционного заболевания, которое лечится в очень короткие сроки и проходит без осложнений. Однако, когда лечение затягивается на долгий период и организм крохи не справляется самостоятельно, то в этом случае возможно появление осложнений:

Кроме того, размножение бактерии может повлечь за собой развитие разных по тяжести заболеваний дыхательной системы, кишечных болезней и сепсиса. Однако, для того, чтобы избежать этих осложнений, необходимо правильно и вовремя диагностировать наличие патогенных микроорганизмов у грудничка.

Диагностика клебсиеллеза

При подозрении у ребенка клебсиеллезной инфекции осмотр проводит врач-гастроэнтеролог или педиатр. Для постановления окончательного диагноза проводится ряд дополнительных исследований. Для этого необходимо сделать забор: кала, мочи, крови, мазка из носовой или ротовой полости, мокроты.

Стоит отметить, что чаще всего врачи диагностируют наличие бактерий клебсиелла пневмония именно в кале, так как она активизируются чаще всего в желудочно-кишечном тракте грудничка.

В очень редких случаях врачи могут обнаружить клебсиеллу в моче. Без наличия каких-либо других симптомов, которые беспокоят грудничка, данное состояние не должно вызывать опасений у родителей и врачей.

Однако, если в то же время у малыша наблюдается повышенная температура, то это может быть признаком ранней стадии пиелонефрита у крохи. В любом случае лечение может быть назначено только тогда, когда диагноз окончательно подтвержден и болезнь сопровождается несколькими симптомами одновременно.

Как лечить клебсиеллу в кале новорожденного

После того как врачи получили результаты анализов, в которых сказано, что у грудничка обнаружена бактерия клебсиелла в кале или в любом другом биоматериале, а кроме того, болезнь сопровождается рядом симптомов, врач обязан подобрать оптимальное лечение данного заболевания. Есть несколько вариантов развития событий: 

  • Если заболевание было диагностировано на ранних сроках, то назначаются щадящие средства для лечения: синбиотики, бактериофаги, пребиотики. Их задачей является восстановление микрофлоры в кишечнике и, соответственно, организм потом сам сможет справиться с процессом размножения этих бактерий.
  • Если же болезнь находится на более поздней стадии или протекает тяжело, то тут никак не обойтись без антибиотиков. Однако, дозировка назначается врачом, исходя из индивидуального состояния здоровья грудничка. Кроме того, прием лекарственных средств также происходит под чутким наблюдением врача. Дополнительно маленькому пациенту могут быть назначены препараты, которые будут вытеснять лишние микроорганизмы из желудочно-кишечного тракта, а также для поднятия иммунитета и восстановления полноценной работы кишечника. На время лечения и восстановительного периода грудничку может быть назначена щадящая диета, которая будет исключать механические и химические раздражители. Если же малыш находится полностью на грудном вскармливании, то корректировке подлежит рацион молодой мамы.

Реабилитация после лечения

После пройденного курса лечения грудничку могут назначить несколько манипуляций для более быстрого восстановления организма. К ним относятся:

  1. Продолжение приема пробиотиков для восстановления микрофлоры кишечника и налаживания пищеварения.
  2. ЛФК, витаминные комплексы, закаливание для повышения иммунитета малыша.
  3. Травяные сборы, которые направлены на восстановление организма и на поднятие иммунитета.

Как избежать клебсиеллеза у ребенка

Если в результатах анализа забранного кала, мочи или другого биоматериала врач увидел незначительное увеличение показателей данной бактерии, то не стоит паниковать. Во всем и всегда придерживайтесь здравого смысла. Если вы начнете лечить болезнь на этом этапе, то вы не дадите возможности организму и иммунной системе крохи «постоять за себя».

Однако в любом случае наиболее правильным вариантом считается выполнение простых правил и манипуляций, которые помогут избежать данного заболевания. К методам профилактики этого заболевания относят:

  • Женщины во время беременности не должны пропускать назначенные приемы врача, кроме того, вы должны регулярно сдавать все анализы, которые показывают наличие патогенных бактерий. В случае, если результаты будут положительными, то вы сможете вовремя принять необходимые меры.
  • Питание будущей матери должно включать оптимальное количество витаминов, минералов и микроэлементов. Все мы знаем, что пузожителю достается львиная доля всех этих элементов. Именно они влияют на развитие и формирование основных систем в организме малыша.
  • Не стоит отказываться от грудного вскармливания. Дело в том, что грудное молоко помогает сформировать сильный иммунитет крохи.
  • Родителям всегда стоит помнить о том, что помещение, в котором находится кроха, необходимо всегда поддерживать в чистоте.
  • Всегда следите за состоянием здоровья малыша. Всегда обращайте внимание на любые недомогания крохи и старайтесь как можно скорее поднять его на ноги. Кроме того, следите и за рационом грудничка. Он должен быть богатым на витамины и минералы. Таким образом вы сможете построить крепкий иммунитет ребенка.
  • Следите за чистотой посуды и предметов, которые окружают его, особенно за теми, с которыми кроха чаще всего контактирует.
  • Уделяйте грудничку достаточное количество внимания и прививайте с самого раннего возраста правила личной гигиены.

Все эти рекомендации помогут вам сформировать крепкий иммунитет у малыша и предотвратить вероятность инфицирования маленького крохи.

Видео

Я предлагаю вам посмотреть небольшой видеосюжет, в котором врач-педиатр рассказывает о возможных кишечных инфекциях у ребенка, а также акцентирует внимание на вопросе появления кебсиеллы в кале грудничка. Кроме того, в данном ролике вы узнаете, как правильно лечить и что делать, если у грудничка обнаружили клебсиеллу пневмонии в кале или в других испражнениях малыша.

Кишечные инфекции – это наверное одно из самых распространенных заболеваний, с которым сталкиваются груднички и их родители. В таком возрасте данные заболевания с трудом поддаются диагностике, однако, только правильное и своевременное постановление диагноза и выполненные все рекомендации врача могут привести к хорошему результату.

Сегодня мы обсудили с вами такое заболевание как клебсиеллез у грудничков. Чаще всего эту бактерию диагностируют именно в кале, так как кишечник – это то место, где активизируется размножение бактерии. Поделитесь теперь вы с нами в х на сайте, находили ли у вашего малыша эту бактерию в кале или других биоматериалах, какое лечение было назначено, и как быстро наступило полное выздоровление.

Клебсиелла у грудничка: причины, симптомы, диагностика и лечение клебсиеллеза

Эта разновидность микроорганизмов может “мирно” существовать в организме здорового человека, обитая на слизистых оболочках или коже и не принося человеку абсолютно никакого вреда. Ребенок может активно потреблять возбудителя через пищу, воду и воздух, и до тех пор, пока иммунитет будет в норме, бактерия не сможет себя проявить.

Новорожденные детки не могут похвастаться отменным иммунитетом – сразу после рождения защитные механизмы организма находятся в крайне ослабленном состоянии, поэтому развитие клебсиеллы у грудничков – распространённое явление.

С первых минут жизни все внутренние органы и системы жизнедеятельности грудничка находятся в состоянии дозревания, именно поэтому нет ничего удивительного в том, что малыши могут страдать от бактерий, которых назвать патогенными можно лишь условно. Такими является не только клебсиелла, к примеру, тот же стафилококк – яркий пример патогенного организма мирно живущего в кожных покровах, но в неблагоприятных условиях, приносящий серьезный вред.

Представители такой разновидности микроорганизмов как энтеробактерии обитают в кишечнике и представляют собой привычных представителей кишечной микрофлоры.

Так выглядит бактерия клебсиеллы у ребенка под микроскопом

Клебсиелла – один из представителей энтеробактерий, имеет вид палочки, длиной порядка 6,0 мкм и относится к типу анаэробных, то есть организм предпочитает размножаться без кислорода.

Услышав это, многие успокаиваются, так как полагают, что в воздухе этому одноклеточному организму делать нечего, однако данный возбудитель отлично чувствует себя в воздушной среде, воде, пищевых продуктах, почве, потому что обладает прочной капсулой, в которой её жизнедеятельности ничего не угрожает. При кипячении, клебсиелла, естественно гибнет.

Существует 8 видов микробов данного типа, которые имеют разные числа антигенов. Тем не менее, патогенной является бактерия Фриндлера (клебсиелла пневмония) и клебсиелла окситока у грудничка.

Эти бактерии предпочитают обитать в пищеварительной системе, в слизистых оболочках дыхательных путей, а также в кожном покрове.

Иммунная система грудничка находится на начальных стадиях формирования, поэтому слизистые оболочки новорожденных настолько стерильны, что рост возбудителя способен нанести детскому организму крайне серьезный урон.

Бактерия Фриндлера – обитает в дыхательных путях, в то время как клебсиелла в кишечнике у грудничка является признаком заражения окситокой.

Причины клебсиеллеза у детей: пути передачи и факторы риска

Факторы риска и основные причины заболевания бактерией клебсиелла у грудничка, по Комаровскому, можно разделить как внешние и внутренние (экзогенные и эндогенные).

Внешние

  • заражение воздушно-капельным путем, то есть когда ребенок заражается от взрослых. Иммунитет взрослого человека при этом спокойно воспринимает клебсиеллу в то время, как для неокрепшего организма это является серьезным испытанием;
  • заражение бытовым (контактным) способом. Речь о передаче микроба через пустышку, тарелку, погремушку и прочие предметы, на которых может оказаться микроб;
  • пищевой способ. Нужно помнить, что организм очень хорошо развивается в кисломолочных и мясных продуктах.

Внутренние

  • ослабление защитных механизмов, явное угнетение иммунной системы;
  • ослабление микрофлоры. Это, как правило, имеет место после приема антибиотиков или в результате недавно вылеченной кишечной инфекции;
  • аллергия. У многих деток, подверженных к различным пищевым аллергиям, есть риск заболеть клебсиеллой.

Очень часто бактерия “сотрудничает” со стафилококком, уничтожая лактобактерии, которые необходимы организму, они снижают микрофлору кишечника, тем самым подготавливая организм к дальнейшему удару.

Первые симптомы

В большинстве случаев, у деток активация клебсиеллы приводит к заболеваниям желудочно-кишечного тракта. Перечислим основные симптомы клебсиеллы у грудничка:

  • Дефекация: примесь крови в кале, учащенные позывы, слизь или остатки непереваренной пищи, зеленоватый цвет кала – всё это не окончательные, но характерные симптомы клебсиеллеза;
  • сильная боль в области живота;
  • тошнота и частые срыгивания;
  • повышение температуры до 39°С;
  • отсутствие аппетита.

В случае если лечение не начать своевременно, у малыша может начаться обезвоживание. Чтобы этого избежать, применяется препарат Регидрон. Пневмония, вызванная клебсиеллой, у новорожденных сопровождается следующими признаками:

  • резкое и острое начало заболевания;
  • высокая температура, как правило выше 39°С;
  • сильный кашель, в выделяемой мокроте могут содержаться прожилки крови.

Какие заболевания вызывает: виды поражений

Бактерия способна вызвать:

  • заболевания желудочно-кишечного тракта, такие как гастрит, а также острые кишечные инфекции;
  • пневмонию и прочите заболевания дыхательных путей, таких как гайморит или ринит;
  • конъюнктивит и прочие воспалительные процессы слизистых оболочек;
  • вагинит у девочек, а также такие заболевания как цистит и пиелонефрит;
  • болезни костной системы, воспаления суставов;

Особо часто клебсиеллезу подвержены новорожденные дети, которые пережили родовые травмы

Особо клебсиеллезу подвержены малыши, которые пережили родовые травмы (в т. ч. гематомы на головке), тяжелые заболевания (даже полное излечение приводит к сильному падению иммунитету и большому риску), а также недоношенные детки.

Зачастую дети из этой группы заражаются клебсиеллой при больничном режиме, то есть подхватывают ее во время лечения.

Поскольку для крепкого организма бактерия не представляет опасности, то найденная клебсиелла в кале у грудничка – не повод бить тревогу. Переходить к лечению следует лишь тогда, когда у малыша появились явные симптомы болезни.

Диагностика

Основным принципом, которые применяются при диагностике клебсиеллы является в микробиологии выделение и идентификация бактерии.

Для исследования принимается кровь, спинномозговая жидкость, анализ кала и пр. После взятия образцов, их засевают на среду К-2 (которая содержит мочевину, рафинозу). Возбудитель обнаруживается как сочный, блестящий и зеленовато-голубой организм.

Лечение: терапевтическая тактика

В случаях, если клебсиеллой поражен кишечник, то назначают:

  • антисептики, такие как Нитроксолин, Фуразолидон, Гентамицин, Амикацин, Сизомицин, Тобрамицин или цефалоспорины 2 и 3 поколений, такие как Цефуроксим, Цефамандол, Цефотаксим, Цефтриаксон;
  • бактериофаги – вирусные препараты, уничтожающие клебсиеллу, но не влияющие на организм;
  • ферменты, такие как Бифиформ, Линекс, Фестал, Панкреатин;
  • растворы, применяемые для регидратации;

Если инфекция приобрела системный характер, то применяют:

  • антибиотики, к которым чувствителен возбудитель во время посева;
  • стимуляторы иммунной системы.

Лечение клебсиеллы продолжается, как правило, на протяжении от одной до трех недель. Ребенку всё это время необходимо находиться на диете, которая представляет собой продукты, содержащие легкоусвояемые витамины.

В случае, если ребенок питается исключительно грудным молоком, то необходима полная коррекция питания кормящей мамы.

Если заболевание проявляет себя не чрезмерно агрессивно, признаки выражены незначительно, то допускается лечение дома под присмотром лечащего педиатра.

Чем опасны для младенцев: осложнения и последствия

Инфекция может вызывать деструкцию дыхательных путей, сепсис, менингит и энцефалит

Клебсиелла способна приводить к деструкциям тканей дыхательных путей и легких. В воспаленных участках может образоваться абсцесс.

Из внелегочных осложнений следует отметить:

  • менингит;
  • в случаях попадания бактерий в кровь, клебсиелла способна вызвать сепсис – крайне опасное состояние;
  • энцефалит;
  • абсцессы в почках;
  • поражения зева;
  • эндокардиты.

При таких осложнениях возбудителя можно обнаружить в моче. Жизнедеятельность возбудителя сопровождается выделением токсинов, поэтому при сильном заражении у ребенка может возникнуть инфекционный шок. Симптомы такого состояния включают заметное снижение давления и нарушение работы внутренних органов. Зачастую, подобное наблюдается при попытках лечить клебсиеллез народными способами.

Реабилитация после лечения

После того как лечение клебсиеллы у грудничка завершено, ребенку необходимо восстановить микрофлору и наладить работу желудочно-кишечного тракта. Для этого, как правило, назначают:

  • прием пробиотиков;
  • прием витаминных препаратов;
  • лечебно-физические упражнения и оздоровительный массаж
  • сборы трав.

Профилактика

Для того чтобы избежать заражения клебсиеллами, нужно соблюдать противоэпидемические правила в:

  • роддомах;
  • больницах, стационарах, хирургических отделениях;
  • отделениях для новорожденных.

Более активно защитить ребенка от клебсиеллы может клебсиеллезная вакцина.

Зачастую после первого курса антибактериальных препаратов, назначают сразу же второй курс. Если существенных изменений после этого нет, должен быть выполнен посев, с целью определить чувствительность организма ребенка к антибиотику. Иначе, получается, что клебсиеллу лечат вслепую.

Также возможно, что клебсиелла была уничтожена, но теперь ребенок страдает от дисбактериоза, симптомы которого очень близки к клебсиеллезу. В таких случаях необходимо сдавать контрольный анализ и решать, что делать далее – пить пребиотики, восстанавливая микрофлору, или далее лечить клебсиеллу.

Всем родителям, которые планируют завести ребенка на заметку: выявленная у будущей матери клебсиелла, не является ни в коем случае показанием к прерыванию беременности. В случаях, когда подобное происходит, необходима консультация специалистов и назначение полного и щадящего для плода лечения, с регулярным наблюдением ребенка.

Многим родителям требуется помнить, что, после рождения, наличие таких организмов как клебсиелла или стафилококк – нормальное явление. Если вы сдали анализы и копрограмма оказалась в норме – это означает, что концентрация клебсиеллы не опасна для здоровья.

Любые проявления сбоев пищеварительной системы при нормальных анализах, означают, что причины расстройств не в клебсиелле. Чрезмерное лечение этого заболевания, в случаях когда его толком нет, но клебсиелла была обнаружена в малом количестве может приводить к дисбактериозам.

Клебсиелла пневмония в кале у грудничка: симптомы, норма в анализе у ребенка

Если у новорожденного или ребенка старшего возраста сильно болит живот, наблюдается усиленный метеоризм или диарея, причиной того может быть клебсиеллезная инфекция.

Клебсиелла (Klebsiella) – это неподвижная энтеробактерия палочковидной формы, относящаяся к классу грамотрицательной флоры. Бактерия может располагаться короткими цепочками или по одной штуке. Палочка покрыта защитной капсулой, что позволяет сохранять ей жизнеспособность в довольно агрессивной среде обитания. Она не боится низких и высоких температур, но при кипячении гибнет.

В организме есть тип микрофлоры, которую называют условно-патогенной. То есть это такие бактерии, которые в состоянии покоя и определенном количестве не приносят вред здоровью.

Но при некоторых условиях они начинают размножаться и паразитировать, вызывая патогенные процессы в организме.

К такому типу бактерий относятся цитробактер, хеликобактер пилори, стрептококк, золотистый стафилококк и клебсиелла, а также почти все семейство энтеробактерий.

Клебсиелла находится в кале у грудничка постоянно, поскольку является неотъемлемой частью его микрофлоры, как и любого другого человека. Тем не менее, заболеванию подвержены больше всего именно новорожденные из-за несформировавшегося полностью желудочно-кишечного тракта.

Разновидности бактерии

Ученые выделают восемь типов палочки, но часто встречающимися и наиболее опасными для новорожденного являются только два:

  • клебсиелла пневмония (pneumoniae) или так называемая палочка Фридлендера,
  • клебсиелла окситока (oxytoca).

Факторы риска или основные причины болезни

Активизироваться и стать патогенной бактерия в организме у ребенка может по разным причинам, как внешним, так и внутренним:

  • от больного взрослого воздушно-капельным путем,
  • через бытовой контакт (грязные руки, плохо вымытую посуду, соску, шерсть животных),
  • через еду (мясо или кисломолочные продукты).
  • в результате снижения иммунитета,
  • в результате нарушения баланса бактерий в микрофлоре кишечника (дисбактериоз),
  • пищевая аллергия.

Также развитию заболевания у малышей способствует недоношенность, прием антибиотиков, патологические роды, врожденные пороки сердца, респираторные вирусные заболевания.

Клебсиелла в кале как у взрослого, так и ребенка не является опасной до тех пор, пока остается в пределах толстого кишечника и ее количество не увеличивается выше нормы.

Активизация и проникновение в другие органы ведет за собой развитие патогенных процессов.

Формы заболевания и возможные осложнения

Возбудитель может вызывать различные болезни в зависимости от того, какой он орган поражает. Чаще всего у детей развивается кишечная инфекция (клебсиеллезный гастроэнтерит), немного реже – воспаление легких клебсиеллезной природы.

Редко, но все же клебсиеллез может бывать в следующих формах:

  • конъюнктивит,
  • клебсиеллезный сепсис, поражающий ткани костей и суставов,
  • заболевания мочеполовой системы.

При несвоевременном лечении и позднем обнаружении заболевания, оно может вызывать ряд серьезных осложнений, таких как дыхательная недостаточность, менингит, миокардит, токсический гепатит, геморрагический синдром.

Клиническая картина заболевания

Условно симптомы недуга можно поделить на две большие группы, в зависимости от того, какой орган поражает бактерия.

Основные признаки со стороны легких

Клебсиеллезная пневмония очень похожа на обычную, то есть пневмококковой природы. Болезнь развивается остро. Температура тела повышается, может достигать 39 гр. и выше. Начинается сильный кашель, который может сопровождаться вязкой кровянистой мокротой, ознобом. При прослушивании отчетливо ощущаются влажные хрипы и ослабленное дыхание в районе очага инфекции. Клебсиелла «пневмония» в кале существенно превышает норму. На рентгеновском снимке может быть обнаружена мелко- или крупноочаговое, а также долевое воспаление.

Патологический процесс развивается альвеолярно, может наблюдаться скапливание жидкости и присоединяться геморрагический компонент (кровоточивость слизистых оболочек). Часто пневмония клебсиеллезного патогенеза имеет склонность к гнойному воспалению тканей (абсцедированию).

Основные проявления со стороны ЖКТ

По симптоматике кишечный клебсиеллез может напоминать энтероколит, энтерит и др. заболевания ЖКТ.

Болезнь характеризуется учащением и разжижением стула, повышением температуры тела, рвотой и срыгиванием (у грудничков).

Испражнения обильные, желто-зеленоватого цвета, имеют непереваренные частицы еды и примеси слизи. В некоторых случаях в каловых массах могут наблюдаться кровянистые сеточки.

Заболевание сопровождается болевыми приступообразными ощущениями в области живота. У малышей и детей старшего возраста наблюдается дискомфорт и беспокойство во время пальпации.

На протяжении всего обострения температура тела держится высокой, может немного снизиться на 5-е сутки. Начало болезни сопровождается частой рвотой, через несколько дней она проходит или случается редко. Обычно на третьи сутки начинается диарея, которая может продолжаться до 10 дней.

Для тяжелых форм заболевания характерны токсикоз (отравление токсинами) и обезвоживание организма в результате сильной рвоты и диареи. Могут фиксироваться такие признаки, как заторможенность, вялость, отсутствие аппетита, отказ от груди, метаболические нарушения.

Изменений в печени, селезенке и других паренхиматозных органах нет. В случае, если клебсиелла в кале у ребенка существенно выше нормы, наблюдается умеренный лейкоцитоз, у новорожденных — гиперлейкоцитоз и анемия, может повышаться СОЭ.

У новорожденных и грудничков болезнь часто протекает в тяжелой форме с потерей веса. Кожа приобретает бледный, немного сероватый оттенок, могут снижаться рефлекторные функции (гипорефлексия) и проявляться синюшность конечностей и слизистых оболочек.

Диагностика и лечение

Основное значение при постановке диагноза имеет анализ кала на клебсиеллу, а также дополнительные бактериологические исследования мочи, крови, рвотных масс, мокроты.Обнаруженная клебсиелла «окситока» или другой штамм в кале еще сама по себе не говорит о заболевании. Ведь ее норма составляет 105 единиц на 1 г каловых масс.

О развитии патогенных процессов стоит говорить при показателях 10 в 6 степени, 7-й, 10 в 8 степени и выше. Очень часто повышенный уровень клебсиеллы обнаруживают вместе с высокой активностью стафилококка.

Также во время диагностики могут использовать динамику титров антител в крови — противоклебсиеллезных агглютининов. Показатели колеблются в районе 1:20- 1:80.

  • Поскольку клебсиэлла не имеет специфических симптомов, и ее клиническая картина характерна для многих других болезней, то точный диагноз может быть установлен только после осмотра гастроэнтеролога или инфекциониста и бактериологических исследований на клебсиеллу.
  • Новорожденные и дети младшего возраста с признаками дегидратации и токсикоза подлежат немедленной госпитализации.
  • В зависимости от формы и тяжести заболевания врач может назначить следующие препараты:
  • антибиотики широкого спектра действия,
  • бактериофаги – препараты избирательного действия, то есть, направлены на уничтожение конкретной бактерии (могут быть комплексными, поливалентными, направленными на определенный штамм бактерии),
  • пробиотики,
  • ферменты,
  • растворы для восстановления водного баланса,
  • в некоторых случаях могут назначаться иммуномодуляторы.

Помимо медикаментозного лечения рекомендуется щадящее диетическое питание.

Восстановление и профилактика

После лечения и купирования симптомов врач обычно назначает комплекс витаминов, массаж и ЛФК, и рекомендует продолжить курс восстановления кишечной микрофлоры и налаживания пищеварения пробиотиками и ферментами.

Профилактика недуга проста, и заключается в выполнении небольшого комплекса правил и рекомендаций:

  • соблюдение гигиены на должном уровне, как личной, так и малыша,
  • продолжительное грудное вскармливание, введение прикорма согласно возрасту, укрепление иммунитета, адекватное лечение ОРВИ,
  • соблюдение санитарно-противоэпидемического режима в роддоме и стационарных отделениях больницы.

Кишечная инфекция или пневмония, вызванная клебсиеллой, — нередкое заболевание, которое может сопровождаться значительной тяжестью протекания, особенно у новорожденных. Но, несмотря на это, имеет благоприятный прогноз на полное выздоровление. Правильное и своевременное лечение проходит без осложнений и не вызывает последствий.

Загрузка…

Клебсиелла у детей — Бактерия клебсиелла в кале у детей, симптомы и лечение

Последнее обновление — 6 ноября 2017 в 21:04

Время на чтение: 4 мин

Нормальная микрофлора состоит из «хороших» и «плохих» бактерий. Для любого родителя диагноз клебсиелла у грудничка звучит грозно. Наш организм постоянно поддерживает равный баланс между всеми бактериями. Бактерии составляют нормальную микрофлору нашей кожи, слизистых и живут внутри нашего кишечника.

Клебсиелла – одна из таких бактерий. Она также содержится в атмосфере, в которой мы живем: в воде, земле, пыли, и даже нашей еде. Случайная находка клебсиеллы в кале с отсутствием основных симптомов далеко не всегда требует лечения.

Наш иммунитет ежедневно успешно борется с вредоносными бактериями, но иногда иммунитет ослабевает, что и приводит к «победе» клебсиеллы над нормальной «хорошей» микрофлорой.

Существует несколько видов клебсиелл:

  1. Klebsiella pneumoniae (палочка Фридлендера) – «клебсиелла пневмония» поражает легочную ткань, вызывает всем известное заболевание — пневмонию.
  2. Klebsiella oxytoca – заселяется в кишечнике, вызывает тяжелое поражение кишечника на фоне общего дисбактериоза. Основные симптомы — температура, тошнота со рвотой, слабость и понос.
  3. Klebsiella rhinoscleromatis (палочка Фриша-Волковича) – поражает слизистую оболочку носа и дыхательные пути.
  4. Klebsiella ozaenae (палочка Абеля-Лавенберга) – вызывает хронические болезни носоглотки с характерным зловонным запахом.

Особенности клебсиеллы

Каждая бактерия обладает определенными и характерными свойствами. Клебсиеллы не двигаются, не образуют спор, имеют особое капсульное строение, за счет этого они устойчивы и долго сохраняются в почве, в водах, и в бытовых условиях.

По классификации она относится к классу анаэробов, это обозначает способность размножаться при отсутствии доступа к кислороду. В условиях комнатной температуры, в холодильной камере, они выживают, и отлично размножаются в молоке. При кипячении до 65 градусов Цельсия начинают погибать в течение одного – полутора часов.

Поскольку клебсиелла способна нанести удар только по ослабленному организму, в основной группе риска:

  1. Ослабленные лица, после перенесенных оперативных вмешательств.
  2. Новорожденные и грудные дети.
  3. Беременные женщины.
  4. Люди пожилого возраста.

Осложнение состояния здоровья на фоне такой бактерии, как клебсиелла у новорожденных детей встречается довольно часто. Поскольку они рождаются с неокрепшей иммунной системой. Симптомы заражения клебсиеллезной инфекцией очень неоднозначны и часто путаются со многими заболеваниями кишечника и желудка.

Именно поэтому лечение порой не помогает, поскольку назначается неверно. В самые первые месяцы после рождения младенец очень уязвим, родители должны беречь его от лишних контактов и внимательно наблюдать за всеми возможными изменениями в поведении и самочувствии малыша.

При малейшем подозрении врача — педиатра на кишечную инфекцию сразу назначается анализ кала. Довольно часто появляется клебсиелла в кале у ребенка. Не всегда нужно сразу бросаться в панику и пытаться это лечить, потому, что данная бактерия в норме должна быть в кишечнике, важна концентрация.

Но есть особые симптомы, когда лечение необходимо.

Симптомы клебсиеллы у детей

Вздутие живота:

  1. Обильные срыгивания, иногда фонтаном (рвота).
  2. Повышенное газообразование (метеоризм).
  3. Капризы и плач на фоне сильной боли в животе.
  4. Слизь в кале или/и кровяные вкрапления. Неприятный кисломолочный запах.
  5. Повышенная температура тела.

Лечение клебсиеллезной кишечной инфекции

Клебсиелла у грудничка довольно серьезное состояние, требующее лечения. Обычно назначаются кишечные антисептики, способные снять воспаление, пробиотики для заселения «хорошей» микрофлоры, ферментные препараты для улучшения пищеварения и регидрон (раствор, восстанавливающий баланс потерянной жидкости).

Не менее важно назначение особых растворов для приема внутрь, иногда и в виде клизмы, называемые бактериофагами. Бактериофаги помогают организму справиться с патогенной микрофлорой и полностью уничтожают и останавливают рост бактерии клебсиелла у детей.

Лекарство необходимо давать в дозировке прописанной врачом — педиатром или врачом — инфекционистом перед кормлением грудного ребенка.

Причины возникновения заболеваний, вызываемых клебсиеллой

В простонародье кишечные инфекции давно называют «болезнью немытых рук». А ведь это не просто так. Чаще всего заражение может произойти из-за несоблюдения элементарных правил санитарной гигиены.

Назовем основные причины:

  • Не соблюдение правил личной гигиены при кормлении малыша грудью. Чаще всего встречается клебсиелла окситока у новорожденных. Поинтересуйтесь заранее у вашего педиатра или консультанта по грудному вскармливанию, как правильно ухаживать, как часто мыть грудь.
  • Аллергические состояния. Любая аллергия ослабляет организм. Поэтому минимизируйте контакты с аллергенами себя и своего грудного ребенка. Необходимо также подобрать правильное лечение аллергии у малыша и мамы, кормящей грудью.
  • Недостаточная развитость иммунитета ребенка. Грудной ребенок появляется на свет как «чистый лист» и очень уязвим. Для развития хорошего иммунитета требуется время. Поэтому минимизируйте контакты с посторонними людьми, когда это возможно. Кормление грудью также способствует становлению хорошего иммунитета, так как материнское молоко содержит природные иммуноглобулины.
  • Ослабление иммунных функций организма после лечения от перенесенной болезни. Полное выздоровление от обычного ОРЗ (например) колеблется от двух до трех недель после возобновления хорошего самочувствия. Особенно берегите малыша в это время.
  • Недостаток витаминов и питательных веществ. Если вы кормите ребенка грудью, то следите за своим питанием. Питание должно быть разнообразным и полезным. Подробнее об этом вам может рассказать врач — гинеколог в роддоме или консультант по ГВ.
  • Лечение малыша антибиотиками. Антибиотики спасли миллиарды жизней людям на всей планете, они помогают от самых различных недугов. Но часто они, же приводят к дисбактериозу. Поэтому в обязательном порядке после лечения антибиотиками нужно проводить восстановительную терапию. Прием лакто и бифидо — бактерий для восстановления микрофлоры кишечника.

Чем опасна клебсиелла для грудничка: симптомы и лечение инфекции

23 ноября 2018 14:00
Антонина Галич, педиатр, семейный врач

Клебсиелла относится к условно-патогенным бактериям и именно ее зачастую считают «виновницей» развития дисбактериоза у малышей. Она действительно очень устойчива к окружающей среде, может сохраняться долгое время, как на предметах, так и на теле человека и погибает лишь спустя 30 минут при температуре 65 градусов. Что делать, чтобы помочь малышу справиться с инфекцией?

Читайте такжеГрудничковый массаж: основные принципы и правила

В наши дни все чаще у грудничков встречаются инфекционные заболевания, вызываемые патогенными микроорганизмами. Одними из них являются палочки Фридлендера, провоцирующие появление клебсиеллы. Несмотря на то, что эти палочки считаются достаточно безобидными и могут находиться повсюду, стремительное увеличение их количества имеет самые неожиданные последствия. В чем же причины их размножения клебсиеллы, какие симптомы можно наблюдать при данном заболевании и есть ли необходимость в его лечении, рассмотрим подробнее в данной статье.

Практически каждый родитель боится в результатах анализов на дисбактериоз увидеть это страшное слово – «клебсиелла». Однако данную бактерию можно встретить практически у всех, так как она является одной из множества бактерий, живущих в организме человека, никак себя не проявляя. Но такое «затишье» длится лишь до тех пор, пока в организме сохраняется оптимальная микрофлора. Если же количество «хороших» бактерий по каким-то причинам резко уменьшается, то патогенные бактерии, к которым относится клебсиелла, становится опасными.

Активизироваться клебсиелла начинает не спонтанно. На это ее могут спровоцировать несколько причин:

  • Ослабление иммунитета
  • Несоблюдение гигиенических условий
  • Неочищенная вода и продукты питания
  • Контакт с носителем инфекции

Важно помнить, что в основном патогенные микроорганизмы проникают в ткани новорожденного через мать в процессе родов или после них. Но так же существуют и другие штаммы, проникающие в организм крохи через пыль, еду, воду и шерсть животных.

Интересно, что по данным исследований ВОЗ, клебсиелла является потенциальным кандидатом на роль супербактерий, то есть бактерий, устойчивых к антибиотикам. А это значит, что они представляют собой угрозу для существования людей как вида в целом.

Для формирования супербактерий достаточно двух причин

Не до конца вылеченные инфекции. Зачастую после начала приема антибиотиков, пациенту становится значительно легче и он преждевременно прекращает прием назначенных медикаментов или же врач просчитывается с назначаемым курсом лечения, что так же может повлиять на развитие супербактерий.

Читайте такжеНасморк у грудного ребенка: причины появления и правильное лечение

Использование антибиотиков в большом количестве. Организм человека со многими инфекциями, включая и кишечные сбои, способен справиться самостоятельно. А злоупотребление антибиотиками крайне негативно сказывается на организме человека, так как применение таких сильных медикаментов приводит к тому, что бактерии адаптируются к ним, а значит, перестают на них реагировать.

Так как клебсиелла считается одной из самых распространенных больничных инфекций, она автоматически становится очень опасной, так как в больницах систематически применяются антибиотики. Это чревато тем, что в любой больнице может сформироваться очень устойчивый штамм, а пациенты этой клиники автоматически станут носителями данной супербактерии.

Чаще всего клебсиелла поражает кишечник новорожденного и больше этому подвержены ослабленные и недоношенные малыши. У грудничков клебсиеллез практически всегда протекает достаточно в тяжелой форме. Опасность данного заболевания состоит в том, что ее симптоматику очень легко перепутать с другими воспалительными процессами желудочно-кишечного тракта, такими как:

  • повышение температуры тела до 37-39 градусов
  • частое срыгивание или рвота, иногда это достигает 6-8 раз в сутки
  • очень частый и обильный жидкий стул до 20 раз в сутки
  • может присутствовать примесь крови в кале новорожденного
  • присутствует сероватый оттенок кожных покровов младенца
  • болезненность в области живота, вследствие чего малыш становится капризным
  • присутствует вялость и заторможенность
  • отсутствует аппетит

Инфекции, вызванные клебсиеллой, длятся дольше остальных кишечных инфекций, чем и отличаются от других подобных заболеваний. В связи с сильным обезвоживанием организма грудничка возникает угроза его жизни! Именно поэтому не стоит заниматься самолечением и при любой кишечной инфекции необходимо своевременно проконсультироваться с лечащим врачом.

Читайте такжеВиды аллергических реакций: как защитить ребенка от аллергии

Клебсиеллу возможно обнаружить лишь с помощью лабораторных исследований. Для этого у пациента берут часть каловых или рвотных масс, мазки из носа, анализ крови, в котором могут произойти некоторые изменения.
Анализ кала на дисбактериоз может быть непоказательным, поэтому в странах с хорошо развитой медициной данный анализ считается бесполезным и не применяется в таких случаях.

Причины, при которых необходимо лечить клебсиеллез:

  • превышенное количество бактерии в кале
  • угнетенное самочувствие ребенка

Если же у ребенка наблюдается хороший аппетит, и он не теряет вес, а набирает его по норме, то лечить клебсиеллез нет необходимости.

В чем заключается лечение клебсиеллеза?

Применение лечения с помощью антибиотиков при таком заболевании как клебсиеллез применяется крайне редко, только лишь в тяжелых случаях. Основная методика лечения при более легкой форме заболевания заключается в гидратации, то есть в восполнении жидкости в организме. Зачастую родители не могут справиться с данной проблемой, поэтому им предлагается госпитализация в клинику.

Существует несколько рекомендаций для профилактики клебсиеллеза:

  • кормить ребенка необходимо только тогда, когда он голоден, так как печень играет немаловажную роль в поддержании иммунной системы человека, а значит, она не должна быть перегружена
  • в рацион маленького ребенка или его мамы (при грудном вскармливании) обязательно должно входить большое количество овощей, фруктов, зелени и круп
  • использовать антибиотики в самых крайних случаях, только тогда, когда без них действительно невозможно обойтись.

Клебсиелла пневмония 10 7 — Педиатрия

Здравствуйте! А на каком вы вскармливании? При ГВ ведь стул может быть и с примесью зелени, и слизи ( примеси слизи особено характерны для детей с аллергической настроенностью). Пенистый стул может быть, если ребёнок просто не досасывается до жирного «заднего» молока, а ограничивается только богатым углеводами передним. .. Впрочем, масса и рост у вас вполне приемлимые для вашего возраста (хотя с учётом данных при рождении прибавки могли бы быть и больше) — так что скорее всего Ваш сынуля высасывает всё молоко ( если, конечно, вы на ГВ).
Я согласна с вашей оценкой антибактериального лечения в вашей ситуации. Но назначать ( или отменять) терапию заочно неверно, неправильно; я же не вижу ребёнка и чего-то могу недооценивать. Может, вам показать малыша хорошему врачу-инфекционисту? Я же без осмотра малыша могу помочь вам только информацией…
В отношении дисбактериоза я высказывала свою позицию неоднократно. Слово «дисбактериоз» означает нарушение нормальной флоры кишечника. Нарушиться ни с того, ни с сего она не может: нужно или заболеть выраженной кишечной инфекцией, или «выбить» всю нормальную флору назначенным по какому-то поводу сильным лекарством вроде антибиотика. Вместе с тем в первые месяцы жизни незрелый ЖКТ ребенка приспосабливается к питанию, совершенствуется и развивается. Это сопровождается закономерными изменениями стула. К дисбактериозу это отношения не имеет.
Дисбиоз — это всегда вторичное состояние; у детей оно развивается или после кишечной инфекции, или после лечения антибиотиками или гормонами. Клиническими проявлениями дисбиоза являются запоры или поносы, боли в животе, его вздутие и пр. прелести.Нередко расстройство кишечной флоры сочетается с аллергическими проявлениями — но последние вполне могут существовать и сами по себе.
То, что микробный состав кала немного отличается от общепринятых норм, ещё ни о чём не говорит. Для определения истинной микробной картины такой анализ, как сделали Вы, нужно проводить как минимум 3 раза — и только при однотипных изменениях можно говорить о реальности такой флоры. Микробы, высеянные из какашек в просвете кишечника, быстро меняются. Правильнее было бы исследовать пристеночную флору — но это трудоемкое и неприятное для малышей обследование.
Клебсиеллы относятся к условно-патогенной флоре. (можно посмотреть http://www.gastroscan.ru/handbook/118/3171). Сами по себе они не опасны. Правда, у вас их чуть больше, чем положено по нормативу — но это повышение, на мой взгляд, некритично ( правда, оговорюсь — я не инфекционист). Я бы советовала вам попробовать такой сбор.
СБОР ДЛЯ ЛЕЧЕНИЯ ДИСБАКТЕРИОЗА
(Авторы – Косов В.А., Ермолин С.И. и др., Центральный клинический военный санаторий «Архангельское»;
был опубликован в «Военно-медицинском журнале» №9, 1996 г., стр. 53-56)

Валериана лекарственная, корень – 2 части
Ромашка аптечная, цветы – 2 части
Мята перечная, лист – 1 часть
Малина обыкновенная, плоды – 2 части

Все компоненты смешать в указанных пропорциях. Авторы рекомендовали дозировать сбор КАПЛЯМИ, но он настолько приятен и полезен, что дети охотно пьют его в больших дозах. 1 столовую ложку смеси заварить 1 стаканом кипятка в термосе, настаивать 2-6 часов ( или ночь). Курс лечения – 1 месяц.
Всегда немного опасаюсь назначать малину малышам — у них часты аллергические реакции на краситель, придающий фруктам и ягодам красный цвет. Для аллергиков даже советую этот компонент сбора исключить; и без него сбор прекрасно «работает». Назначала его не раз. Попробуйте — может, и вам поможет. Удачи!

Нашей девочке 4,5 месяца. Мы полностью на ГВ. За все это время стул ребенка нестабилен: в основном жидкий с непереваренными комочками, иногда просто водой, очень часто сплошная слизистая тягучая масса зеленого цвета. Кроме того, что всегда после кормления долго остается надутая, как шарик, и мучается пуками, но без капризов- нас ничего не беспокоит. Решили сдать анализ на дисбактериоз. У мамы в молоке в одной груди обнаружили Стафилококк epidermikus c не очень мне понятной припиской «немассивная обсемененная». Кал ребенка, картина такая: Патогенной флоры — не обнаружено. E.coli с нормальной ферментной активностью – 15*10 в 10 E.coli со сниженной ферментной активностью – 0 E.coli гемолитические- 0 Золотистый стафилококк- 4* 10 во 2 Бифидо

13 Дек Нашей девочке 4,5 месяца. Мы полностью на ГВ. За все это время стул ребенка нестабилен: в основном жидкий с непереваренными комочками, иногда просто водой, очень часто сплошная слизистая тягучая масса зеленого цвета.

Кроме того, что всегда после кормления долго остается надутая, как шарик, и мучается пуками, но без капризов- нас ничего не беспокоит. Решили сдать анализ на дисбактериоз. У мамы в молоке в одной груди обнаружили Стафилококк epidermikus c не очень мне понятной припиской «немассивная обсемененная». Кал ребенка, картина такая: Патогенной флоры – не обнаружено. E.coli с нормальной ферментной активностью – 15*10 в 10 E.coli со сниженной ферментной активностью – 0 E.coli гемолитические- 0 Золотистый стафилококк- 4* 10 во 2 Бифидо- 10в 9 Лакто – 10 в 8 Клебсиелла – 3* 10 в7. Нужно ли лечиться маме и как лечить ребенка, не прибегая к антибиотикам, по более щадящей , но надежной схеме. Нужно ли вообще лечить ребенка с такими анализами и беспокойным стулом? Будем очень благодарны за консультацию

Posted at 14:24h
in вопрос-ответ
by admin

У Вашего ребёнка дисбиоз кишечника, аэробно-анаэробный, декомпенсированный. Лечение требуют два микроба:

 

–         Стафилококк золотистый ( Staphylococcus aureus) — факультативный и наиболее частый возбудитель стафилококкоза, частый представитель микрофлоры носа и кожи

 

Стафилококк золотистый способен вызывать целую вереницу болезней, от минорных заболеваний кожи, таких как прыщи, папулы, пиодермия, фурункулы, целлюлит, гиподермит, жировая гранулема, карбункулы и т.д.Под его влияние попадают многие органы: кожа, мягкие ткани, кости, суставы; вызывает инфекции в ранах. Как и прежде относится к числу пяти наиболее частых причин нозокомиальных (больничных) инфекций, часто является причиной постоперационных ран (нагноений).

 

–         Клебсиелла ( Klebsiella) — условно-патогенная бактерия.

Представители рода встречаются в фекалиях человека, на коже и слизистых дыхательных путей, в почве, воде, фруктах и овощах. Благодаря капсуле устойчивы в окружающей среде. Бактерии этого рода Вызывают пневмонию, урогенитальные инфекции, в том числе у новорожденных, у ослабленных и пожилых лиц, конъюнктивиты, менингиты, сепсис, острые кишечные инфекции.  Klebsiella pneumoniae subsp. ozaenae и Klebsiella pneumoniae subsp. rhinoscleromatis вызывают соответственно озену и риносклерому (гранулематозное поражение слизистой оболочки верхних дыхательных путей).

Для лечения дисбиоза кишечника Вам необходимо обратиться к педиатру по месту жительства или вызвать врача из «Доброго Доктора» по телефону 8029-333-88-77 ежедневно с 9.00 до 19.00.

Эпидермальный стафилококк, который был обнаружен у мамы, в лечении не нуждается.

Klebsiella oxytoca в кале | Косметика Грин Мама

Я искала KLEBSIELLA OXYTOCA В КАЛЕ. НАШЛА! В роду Klebsiella различают несколько видов бактерий, но заболевания вызываются четырьмя из них:
1 и 2. Клебсиеллы Окситока и Фридлендера Лечить малыша нужно, только если превышена норма количества бактерий в кале. Пневмония.
«окситока» – klebsiella oxytoca Возбудитель кишечных патологий может определиться в кале здорового ребенка, когда родители сдают образец для проведения посева на микрофлору.
Что такое клебсиелла окситока?

Симптомы, способы диагностики klebsiella oxytoca у взрослого и у ребенка в моче, кале, мазке. Причины появления, лечение инфекции бактериофагами.
Что означает клебсиелла в кале у грудничка. Лечение клебсиллиоза – антибиотики или бактериофаги?

Для человека опасны три вида клебсиелл:
K. Pneumoniae; K. Oxytoca
Клиническая картина klebsiella oxytoca у ребенка. Клебсиелла окситока ребенка атакует после общения с инфицированным носителем. Показатель klebsiella oxytoca в кале у грудничка 10 в 8 степени считается значительным отклонением от
Клебсиелла в кале у грудничка. При заболевании у грудничка меняется характер и цвет стула. Наиболее актуальными для грудничков являются klebsiellapneumonia («пневмония») и klebsiella oxytoca («окситока».)
Последняя классификация выделяет следующие виды klebsiella oxytoca; pneumoniae. Внешний вид клебсиеллы. Klebsiella oxytoca в кале- ПРОБЛЕМЫ БОЛЬШЕ НЕТ!

Клебсиелла окситока в кале у малыша.
Микроорганизм klebsiella oxytoca относится к категории грамотрицательных бацилл. при поражении пищеварительного тракта обнаруживается клебсиелла в кале, в дуоденальном содержимом, а также в желчи
Клебсиелла у грудничка в кале является частью микрофлоры кишечника. Если число микробов не превышает нормы, то опасности нет. Клебсиелла в кале у ребенка при определенных условиях может резко
Что делать в случае обнаружения клебсиеллы пневмонии или окситоки в кале. Клебсиелла в кале чаще всего обнаруживается в превышающем норме количестве при расстройствах работы органов ЖКТ.
klebsiella oxytoca (клебсиелла окситока). Лечением клебсиеллы в кале должен заниматься специалист. При легкой форме протекания инфекционного заболевания, как правило, назначают пробиотики
Клебсиелла (Klebsiella) – это неподвижная энтеробактерия палочковидной формы, относящаяся к классу грамотрицательной флоры. клебсиелла окситока (oxytoca).
Klebsiella oxytoca – заселяется в кишечнике, вызывает тяжелое поражение кишечника на фоне общего дисбактериоза. Довольно часто появляется клебсиелла в кале у ребенка.
К одному из таких видов относится Klebsiella oxytoca. В лабораторных условиях Клебсиеллу окситока можно обнаружить в кале, моче, мокроте, мазке из ротовой или носовой полости, в спинномозговой жидкости, желчи.
Что представляет собой паразит Клебсиелла Окситока. Почему она возникает в моче, кале и зеве у грудничков и как ее лечить?

Клебсиелла Окситока (Кlebsiella oxytoca) – это условно-патогенный микроорганизм из рода энтеробактерий
Анализы показали:
углеводы 0,3-0,5; Klebsiella oxytoca в титре 10в8; Staphylococcus aureus в титре 10в6; бифидобактерии — Не обнаружено в титре 10в5 и Насморк у грудничка 39. Прожилки крови, светло-красная слизь в кале у ребенка 6 месяцев 37.
Klebsiella oxytoca (клебсиелла окситока). Анализ кала на клебсиеллу. Количество клебсиелл в кале подсчитывают при анализе на дисбактериоз. Klebsiella oxytoca в кале— 100 ПРОЦЕНТОВ!

пневмонии (Klebsiella pneumoniae) становится причиной пневмонии, а окситока клебсиелла (Klebsiella oxytoca) — малоприятные Симптомы и признаки. Если в анализе кала у малыша обнаружены клебсиеллы, то этот факт нельзя считать
Норма показателей клебсиеллы в кале ребенка. Чтобы определить количество бактерий в кале ребенка, необходимо сдать анализ на дисбактериоз.
Клебсиелла пневмония. Можно обнаружить клебсиеллу пневмонию:
в кале у взрослого больного; в мокроте Клебсиелла окситока у взрослого больного. Исследуется и выявляется нахождение клебсиеллы
http://www.greenmama.ru/nid/3376718/
http://www.greenmama.ru/nid/3376724/
http://www.greenmama.ru/nid/3465253/
http://www.greenmama.ru/nid/3425627/

Пробиотики Нормофлорины – лечение дисбактериоза

Назад к списку


29.03.2012

Загрузка. ..

В современном мире наблюдается рост инфекционных заболеваний, вызванных различными условно-патогенными микроорганизмами, в частности, бактериями рода Клебсиелла (лат. Klebsiella). Это палочковидный микроорганизм семейства энтеробактерий. В роде клебсиелл выделяют четыре вида. Чаще всего встречается палочка Фридлендера, вызывающая воспаление легких и Klebsiella oxytoca – поражающая желудочно-кишечный тракт – толстый кишечник.

Клебсиелла живет в организме совершенно здоровых людей, являясь одним из элементов нормальной флоры кишечника. В норме klebsiella может присутствовать на коже, на слизистой оболочке дыхательных путей человека и животных. Бактерия может существовать в почве, воде, пище, пыли. Она является одной из самых распространённых внутрибольничных инфекций. Клебсиелла попадает в желудочно-кишечный тракт с плохо вымытых рук, овощей и фруктов, с водой, с почвой. Когда клебсиелла находится в организме, она имеет палочкообразную форму, но, попав в окружающую среду, начинает видоизменяться – она округляется и покрывается специальной оболочкой – капсулой! Благодаря этому приспособлению, Клебсиеллы весьма устойчивы к действию факторов окружающей среды и высоким температурам.

В случаях ослабления собственных факторов защиты – иммунитета, клебсиелла активно размножается в тканях и вызывает эндотоксемию, воспалительный процесс в органах. Особенно часто встречаются заболевания, вызванные клебсиеллой, у грудничков. Это связано с особенностью иммунитета малышей и недостаточностью при рождении нормальных микроорганизмов в кишечнике, дыхательных путях, на коже. Симптомы клебсиеллы у грудничка схожи с симптомами дисбактериоза. Поэтому, при любом расстройстве стула, нужно обязательно сдать кал ребёнка на анализ, чтобы точно выявить, какие именно бактерии вызвали изменение состояния ребёнка. У грудничка Клебсиелла может вызывать симптомы инфекционного заболевания, протекающего в лёгкой форме, а может, в зависимости от силы иммунитета, приводить к тяжёлому течению: с повышением температуры, ознобом, лихорадкой, болями в животе, диареей и сильным обезвоживанием организма. При появлении таких симптомов необходимо обратиться к врачу, а также сдать кал малыша на исследования. Если в анализе была выявлена клебсиелла, но заболевание малыша протекает в лёгкой форме, то лечение проводят пробиотиками, синбиотиками – Нормофлоринами. Большую роль в восстановлении иммунитета и нормальной микрофлоры у малыша играет грудное вскармливание. При высокой обсеменённости клебсиеллой и тяжёлой форме заболевания назначают сложную терапию с применением антибиотиков. В ряде случаев у грудничка обнаруживается повышенное содержание клебсиеллы в кале, но при этом он чувствует себя нормально. Тогда препараты с лакто- и бифидобактериями – биокомплексы Нормофлорины назначают для вытеснения излишнего количества клебсиеллы, повышения иммунитета и улучшения собственной полезной микрофлоры.

Кроме того, под действием клебсиеллы могут развиваться такие тяжелые заболевания, как пневмония, воспалительные заболевания мочевыводящих путей, менингит, конъюнктивит, или более редкие болезни – озена (зловонный насморк),  риносклерома. Симптомы и признаки инфекций, вызываемых клебсиеллами, в частности инфекций мочеполовой системы, желчных путей и и других органов ЖКТ, сходны с симптоматикой инфекций, обусловленных кишечной палочкой. Кишечные заболевания, ассоциированные с клебсиеллой, часто вызываются смешанной флорой. Клебсиеллы являются родственниками бактерий рода Serratia и рода Enterobacter и их трудно, но можно дифференцировать только с помощью специальных проб. А делать это необходимо, потому что, Klebsiella, Serratia и Enterobacter обладают различной чувствительностью к противомикробным препаратам. Комплексное лечение заболеваний, вызванных клебсиеллой, зависит от локализации и выраженности патологического процесса. Антибиотики назначают в тяжелых случаях по чувствительности, при легком течении или обнаружении в анализах не применяют. Обязательно в лечении используют препараты, восстанавливающие кишечную микрофлору, ведь только в организме с нормальной здоровой микрофлорой не сможет активизироваться и развиться патогенная флора!

Как правило, антимикробную терапию рекомендуют начинать еще до получения результатов посева и определения лекарственной чувствительности к антибиотикам. В этом случае незаменимы пробиотики – биокомплексы Нормофлорины, содержащие продукты жизнедеятельности живых лакто- и бифидобактерий с активным антисептическим, противовоспалительным действием, оказывает лечебный эффект при клебсиеллёзах, что доказано многолетней практикой и научными исследованиями, которые показали максимальную эффективность Нормофлоринов (Л и Б) в сравнении с другими бифидо- и лактосодержащими препаратами.

Читайте также:

Симптомы клебсиеллёза

Назад к списку

Анализ кала на дисбактериоз

Анализ кала на дисбактериоз

Представлены обобщенные сведения о традиционном микробиологическом анализе кала культурально-зависимым способом (бакпосевом).

О новых методиках анализа кишечной микробиоты информация ниже.

Анализ кала на дисбактериоз или Бактериологический посев (посев или бакпосев). Посев — это биологическое исследование испражнений, которое определяет состав и примерное количество микроорганизмов, обитающих в кишечнике человека. Для этого используется внесение частиц кала на разные питательные среды, на которых растут 3 группы микроорганизмов: нормальные (необходимы для переваривания пищи), условно-патогенные (способные при снижении естественной резистентности макроорганизма вызывать заболевания, для которых характерно отсутствие нозологической специфичности) и патогенные (болезнетворные). Указанное лабораторное исследование используется в медицинской практике с профилактической целью и при подозрении на инфекционное заболевание желудочно-кишечного тракта. 

Данное исследование позволяет определить содержание бактерий в толстом кишечнике. В кишечнике человека содержится огромное количество бактерий, которые активно участвуют в переваривании и усвоении питательных веществ. Анализ кала на дисбактериоз назначается по большей части детям, в таких случаях, когда имеются следующие нарушения работы кишечника: диарея, запор, боли в животе, метеоризм, а также после длительного лечения антибиотиками (антибиотики помимо того, что борются с инфекциями, уничтожают и нормальные бактерии кишечника). Существую три группы бактерий кишечника – «нормальные» бактерии (бифидобактерии, лактобактерии и эшерихии) они активно участвуют в работе кишечника, условно-патогенные бактерии  (энтерококки, стафилококки, клостридии, кандиды) при определенных обстоятельствах могут превратиться в патогенные бактерии и вызвать различные заболевания, и патогенные бактерии (шигелла, сальмонелла) которые при попадании в кишечник вызывают серьезные инфекционные заболевания кишечника.

Нормы анализа кала на дисбактериоз

(КОЕ / г фекалий)

 

Дети до 1 года

Дети старшего возраста

Взрослые

Бифидобактерии

1010 – 1011

109 – 1010

108 – 1010

Лактобактерии

106 – 107

107 – 108

106 – 108

Эшерихии

106 – 107

107 – 108

106 – 108

Бактероиды

107 – 108

107 – 108

107 – 108

Пептострептококки

103 – 105

105 – 106

105 – 106

Энтерококки

105 – 107

105 – 108

105 – 108

Сапрофитные стафилококки

≤104

≤104

≤104

Патогенные стафилококки

Клостридии

≤103

≤105

≤105

Кандида

≤103

≤104

≤104

Патогенные энтеробактерии

Бифидобактерии

Норма бифидобактерий

Дети до 1 года

1010 – 1011

Дети старшего возраста

109 – 1010

Взрослые

108 – 1010

Около 95% всех бактерий в кишечнике – бифидобактерии. Бифидобактерии участвуют в производстве таких витаминов как В1, В2, В3, В5, В6, В12,К. Помогают всасыванию витамина D, при помощи специальных вырабатываемых ими веществ борются с «плохими» батериями, а также участвуют в усилении иммунитета.

Причины снижения количества бифидобактерий

  • Медикаментозное лечение (антибиотики, нестероидные противовоспалительные средства (НПВС) такие как анальгин, аспирин, слабительные средства)
  • Неправильное питание (избыток жиров или белков или углеводов, голодание, неправильный режим питания, искусственное вскармливание)
  • Кишечные инфекции (дизентерия, сальмонеллез, вирусные инфекции)
  • Ферментопатии (целиакия, лактазная недостаточность)
  • Хронические заболевания ЖКТ (хронический гастрит, панкреатит, холецистит, язвенная болезнь желудка или двенадцатиперстной кишки)
  • Иммунные заболевания (иммунные дефициты, аллергии)
  • Смена климатических зон
  • Стресс

Лактобактерии

Норма лактобактерий

Дети до 1 года

106 – 107

Дети старшего возраста

107 – 108

Взрослые

106 – 108

Лактобактерии занимают около 4-6% от общей массы бактерий кишечника. Лактобактерии являются не менее полезными, чем бифидобактерии. Их роль в организме следующая: поддержка уровня pH в кишечнике, производство большого количества веществ (молочная кислота, уксусная кислота, перекись водорода, лактоцидин, ацидофилин), которые активно используются для уничтожения патогенных микроорганизмов, а также вырабатывают лактазу.

Причины снижения количества лактобактерий

  • Медикаментозное лечение (антибиотики, нестероидные противовоспалительные средства (НПВС) такие как анальгин, аспирин, слабительные средства)
  • Неправильное питание (избыток жиров или белков или углеводов, голодание, неправильный режим питания, искусственное вскармливание)
  • Кишечные инфекции (дизентерия, сальмонеллез, вирусные инфекции)
  • Хронические заболевания ЖКТ (хронический гастрит, панкреатит, холецистит, язвенная болезнь желудка или двенадцатиперстной кишки)
  • Стресс

Эшерихии (E.coli типичные)

Норма эшерихий

Дети до 1 года

107 – 108

Дети старшего возраста

107 – 108

Взрослые

107 – 108

Эшерихии появляются в организме человека с рождения и присутствуют в нем на протяжении всей жизни. Выполняют следующую роль в организме: участвуют в образовании витаминов группы В и витамина К, участвуют в переработке сахаров, вырабатывают антибиотикоподобные вещества (колицины) которые борются с патогенными организмами, усиливают иммунитет.

Причины снижения количества эшерихий

  • Гельминтозы
  • Лечение антибиотиками
  • Неправильное питание (избыток жиров или белков или углеводов, голодание, неправильный режим питания, искусственное вскармливание)
  • Кишечные инфекции (дизентерия, сальмонеллез, вирусные инфекции)

Бактероиды

Норма бактероидов в кале

Дети до 1 года

107 – 108

Дети старшего возраста

107 – 108

Взрослые

107 – 108

Бактероиды участвуют в пищеварении, а именно в переработке жиров в организме. У детей до 6 месяцев в анализах кала не обнаруживаются, их можно обнаружить, начиная с возраста 8-9 месяцев.

Причины увеличения содержания бактероидов

  • Жировая диета (употребление большого количества жиров в пищу)
  • Лечение антибиотиками
  • Кишечные инфекции (дизентерия, сальмонеллез, вирусные инфекции)

Причины снижения содержания бактероидов

  • Лечение антибиотиками
  • Кишечные инфекции (дизентерия, сальмонеллез, вирусные инфекции)

Пептострептококки

Нормальное количество в кале

Дети до 1 года

103 – 105

Дети старшего возраста

105 – 106

Взрослые

105 – 106

В норме пептострептококки живут в толстом кишечнике, при увеличении их количества и  попадании в любую другую область нашего организма, они вызывают воспалительные заболевания. Участвуют в переработке углеводов и молочных белков. Вырабатывают водород, который в кишечнике превращается в перекись водорода и помогает контролировать рН в кишечнике.

Причины увеличения содержания пептострептококков

  • Употребление большого количества углеводов
  • Кишечные инфекции
  • Хронические заболевания ЖКТ

Энтерококки

Норма энтерококков

Дети до 1 года

105 – 107

Дети старшего возраста

105 – 108

Взрослые

105 – 108

Энтерококки участвуют в переработке углеводов, в производстве витаминов, а также играют роль в создании местного иммунитета (в кишечнике). Количество энтерококков не должно превышать количество кишечных палочек, если их количество увеличивается, они могут вызвать ряд заболеваний.

Причины увеличения содержания энтерококков

  • Снижение иммунитета, иммунные заболевания
  • Пищевые аллергии
  • Гельминтозы
  • Лечение антибиотиками (в случае резистентности энтерококков к применяемому антибиотику)
  • Неправильное питание
  • Снижение количества кишечной палочки (эшерихии)

Стафилококки (сапрофитные стафилококки и патогенные стафилококки)

Норма сапрофитных стафилококков

Дети до 1 года

≤104

Дети старшего возраста

≤104

Взрослые

≤104

Норма патогенных стафилококков

Дети до 1 года

Дети старшего возраста

Взрослые

Стафилококки делятся на патогенные и непатогенные. К патогенным относятся: золотистый, гемолитический и плазмокоагулирующий, наиболее опасен золотистый. К непатогенным стафилококкам относятся негемолитический и эпидермальный.

Стафилококк не относится к нормальной микрофлоре кишечника, он попадает в организм из внешней среды вместе с пищей. Золотистый стафилококк, попадая в ЖКТ, обычно, вызывает токсические инфекции.

Причины появления стафилококка 

Стафилококк может попасть в организм человека разными путями, начиная грязными руками, вместе с продуктами питания и заканчивая внутрибольничными инфекциями.

Клостридии

Норма клостридий

Дети до 1 года

≤103

Дети старшего возраста

≤105

Взрослые

≤105

Клостридии участвуют в переработке белков, продуктом их переработки являются такие вещества как индол и скатол, которые по сути являются ядовитыми веществами, однако в небольших количествах эти вещества стимулируют перистальтику кишечника тем самым улучшая функцию эвакуации каловых масс. Однако при увеличении количества клостридий в кишечнике вырабатывается большее количество индола и скатола, что может привести к развитию такого заболевания как гнилостная диспепсия.

Причины увеличения количества клостридий

  • Большое количество белка употребляемого в пищу

Кандида

Норма кандид

Дети до 1 года

≤103

Дети старшего возраста

≤104

Взрослые

≤104

При увеличении количества кандид в кишечнике может развиться бродильная диспепсия, а также заметное увеличение количества кандид может спровоцировать развитие различных видов кандидоза.

Причины увеличения количества кандид

  • Употребление большого количества углеводов в пищу
  • Лечение антибиотиками (без применения в комплексе противогрибковых препаратов)
  • Использование гормональных противозачаточных средств
  • Беременность
  • Сахарный диабет
  • Стресс

Анализ кала на патогенную флору

Анализ кала на патогенную флору является тем же самым анализом кала на дисбактериоз. В бланке с результатами анализов он занимает место – Патогенные энтеробактерии. К группе патогенных энтеробактерий относят Сальмонеллу и Шигеллу как основных возбудителей инфекционных заболеваний кишечника.

Патогенные (болезнетворные) бактерии (pathogenic bacteria,  греч. pathos — страдание и genes — порождающий, рождающийся; греч. bacterion — палочка) — бактерии, паразитирующие на других организмах и способные вызывать инфекционные заболевания человек, среди которых особое место занимают кишечные инфекции. Кишечные инфекции — целая группа заразных заболеваний, которые в первую очередь повреждают пищеварительный тракт. Заражение происходит при попадании возбудителя инфекции через рот, как правило, при употреблении зараженных пищевых продуктов и воды. Всего таких заболеваний более 30, в частности, к ним относятся: холера, брюшной тиф, ботулизм, сальмонеллез, дизентерия и т.п. Среди кишечных заболеваний самое безобидное — это пищевое отравление. Возбудителями кишечных инфекций могут быть как сами бактерии (сальмонеллез, брюшной тиф, холера), так и их токсины (ботулизм). Некоторые бактерии могут вызывать язвенную болезнь и рак желудка, а также хронический гастрит.

 Сальмонелла

В норме сальмонеллы в результате анализа быть не должно!

Вызывает такое заболевание как сальмонеллез, которое проявляется сильным токсическим поражением кишечника. Основными переносчиками являются водоплавающие птицы.
Причины появления сальмонеллы

  • Употребление плохо обработанного или сырого мяса
  • Употребление плохо обработанных или сырых яиц
  • Контакт с переносчиками
  • Контакт с водой зараженной сальмонеллой
  • Грязные руки

Шигелла

В норме шигеллы в результате анализа быть не должно!

Вызывает такое заболевание как дизентерия, которое также поражает кишечник и проявляется сильным токсическим поражением кишечника. Основными путями заражения являются молочные продукты, сырые овощи, зараженная вода, люди больные дизентерией.

Причины появления шигеллы

  • Употребление или контакт с зараженной водой
  • Употребление зараженных продуктов питания
  • Контакт с людьми болеющими дизентерией
  • Грязные руки и контакт с зараженными поверхностями (посуда, игрушки)

Часто задаваемые вопросы

 

Как правильно подготовиться к анализу?

Применение некоторых медикаментов может повлиять на результат анализа кала. Поэтому их применение необходимо приостановить или прекратить в период подготовки к сдаче анализа кала после консультации с вашим врачом.

  • Отменить прием препаратов (после личной консультации Вашего лечащего врача). К препаратам, которые могут повлиять на результаты анализов кала, относятся следующие:
  1. Противодиарейные препараты (Смекта, Неосмектин, Полифан, Имодиум, Энтерол)
  2. Противогельминтные препараты (Немозол, Декарис, Вермокс, Гельминтокс)
  3. Антибиотики — любые виды
  4. Лечебные и очищающие клизмы
  5. Слабительные препараты (Бисакодил, Экстракт сенны, Форлакс, Порталак)
  6. НПВП – нестероидные противовоспалительные препараты (Аспирин, Парацетамол, Ибупрофен)
  • Также нельзя использовать кал который был в контакте с чистящими или дезинфицирующими средствами, которые используются для чистки унитаза, водой или мочой.

 Как правильно собрать кал для анализа?

  1. Помочитесь перед сбором материала, для того чтобы моча не попала в кал.
  2. Необходимо взять чистую, сухую ёмкость, куда будет проводиться дефекация.
  3. Из полученного материала необходимо взять 8-10 см3 (~2 чайные ложки). Кал забирается при помощи специальной «ложки» которая встроена в крышку специального контейнера, который вам должны выдать для сбора кала.
  4. Кал для анализа собирается из разных участков каловых масс (сверху, с боков, изнутри)
  5. Материал (кал) кладется в выданный вам контейнер, и плотно закрывается.
  6. Необходимо подписать контейнер (Ваше имя и фамилию, дату сбора анализа)

Как хранить кал перед отправкой в лабораторию? 

Материал для анализа кала на дисбактериоз и на кишечную инфекцию необходимо доставить в лабораторию в максимально короткие сроки 30-40 минут (максимум 1,5 -2 часа). Чем больше времени прошло со времени сбора материала и момента доставки материала в лабораторию, тем менее достоверны будут анализы. Проблема в том, что большая часть бактерий кишечника являются анаэробными, то есть они живут в среде без кислорода, при контакте с ним умирают. Это может повлиять на достоверность результата. Поэтому хранить хоть какое либо время свыше рекомендуемых максимальных 2 часа, категорически не рекомендуется.


Примечание

Полный (максимально подробный и точный) микробиологический анализ кала (анализ микробиоты толстой кишки) невозможно провести культурально зависимым способом, т.к. не все бактерии можно выделить и культивировать в искусственных условиях. В общем, проблема с микробиомом состоит в том, что мы можем выращивать в лаборатории менее 5% видов микробов, остальные просто слишком привередливы. Сегодня используются более технологичные культурально-независимые методы анализа:

Обзор популярных методов анализа микробиоты

 

Современные анализы кишечной микробиоты проводятся культурально-независимыми способами, среди которых можно выделить два наиболее известных на сегодняшний день в России метода — метод газовой хроматографии масс-спектрометрии микробных маркеров и метагеномный анализ микробиоты с помощью секвенирования нуклеиновых кислот. Обе методики имеют свои преимущества и недостатки (стоимость, время), включая погрешности в самих результатах и ограничения в использовании, а поэтому они совершенствуются до сих пор. Но несмотря на определенные недочеты, указанные технологии при грамотном использовании все же являются мощным инструментарием на пути к достижению целей персонализированнной медицины.

Информация к разделу: Дисбактериоз

См. отдельно: Типичный анализ микробиома кишечника по образцам стула (метод метагеномики)

Будьте здоровы!

 

ССЫЛКИ К РАЗДЕЛУ О ПРЕПАРАТАХ ПРОБИОТИКАХ

  1. ПРОБИОТИКИ
  2. ДОМАШНИЕ ЗАКВАСКИ
  3. БИФИКАРДИО
  4. КОНЦЕНТРАТ БИФИДОБАКТЕРИЙ ЖИДКИЙ
  5. ПРОПИОНИКС
  6. ЙОДПРОПИОНИКС
  7. СЕЛЕНПРОПИОНИКС
  8. МИКРОЭЛЕМЕНТНЫЙ СОСТАВ
  9. ПРОБИОТИКИ С ПНЖК
  10. БИФИДОБАКТЕРИИ
  11. ПРОПИОНОВОКИСЛЫЕ БАКТЕРИИ
  12. ПРОБИОТИКИ И ПРЕБИОТИКИ
  13. СИНБИОТИКИ
  14. РОЛЬ МИКРОБИОМА В ТЕРАПИИ РАКА
  15. АНТИОКСИДАНТНЫЕ СВОЙСТВА
  16. АНТИОКСИДАНТНЫЕ ФЕРМЕНТЫ
  17. АНТИМУТАГЕННАЯ АКТИВНОСТЬ
  18. МИКРОФЛОРА КИШЕЧНОГО ТРАКТА
  19. МИКРОБИОМ ЧЕЛОВЕКА
  20. МИКРОФЛОРА И ФУНКЦИИ МОЗГА
  21. ПРОБИОТИКИ И ХОЛЕСТЕРИН
  22. ПРОБИОТИКИ ПРОТИВ ОЖИРЕНИЯ
  23. МИКРОФЛОРА И САХАРНЫЙ ДИАБЕТ
  24. ПРОБИОТИКИ и ИММУНИТЕТ
  25. МИКРОБИОМ И АУТОИММУННЫЕ БОЛЕЗНИ
  26. ПРОБИОТИКИ и ГРУДНЫЕ ДЕТИ
  27. ПРОБИОТИКИ, БЕРЕМЕННОСТЬ, РОДЫ
  28. ДИСБАКТЕРИОЗ
  29. ВИТАМИННЫЙ СИНТЕЗ
  30. АМИНОКИСЛОТНЫЙ СИНТЕЗ
  31. АНТИМИКРОБНЫЕ СВОЙСТВА
  32. СИНТЕЗ ЛЕТУЧИХ ЖИРНЫХ КИСЛОТ
  33. СИНТЕЗ БАКТЕРИОЦИНОВ
  34. ФУНКЦИОНАЛЬНОЕ ПИТАНИЕ
  35. АЛИМЕНТАРНЫЕ ЗАБОЛЕВАНИЯ
  36. ПРОБИОТИКИ ДЛЯ СПОРТСМЕНОВ
  37. ПРОИЗВОДСТВО ПРОБИОТИКОВ
  38. ЗАКВАСКИ ДЛЯ ПИЩЕВОЙ ПРОМЫШЛЕННОСТИ
  39. НОВОСТИ

Колонизация микроорганизмов

координирует патогенез детского изолята Klebsiella pneumoniae

  • 2.

    Мартин, Р. и др. .События раннего возраста, включая способ доставки и тип кормления, братьев и сестер и пол, формируют развивающуюся микробиоту кишечника. PLoS ONE 11 , e0158498 (2016).

    Артикул
    PubMed Central

    Google ученый

  • 3.

    Корпела, К. и др. . Развитие кишечной микробиоты и гестационный возраст у недоношенных новорожденных. Научный сотрудник 8 , 2453 (2018).

    ADS
    Статья
    PubMed Central

    Google ученый

  • 4.

    Догра, С. и др. . На динамику микробиоты кишечника младенца влияют способ родоразрешения и продолжительность беременности, и она связана с последующим ожирением. МБио 6 (2015).

  • 5.

    Harmsen, H.J. et al. . Анализ развития кишечной флоры у детей, находящихся на грудном и искусственном вскармливании, с использованием методов молекулярной идентификации и обнаружения. J Pediatr Gastroenterol Nutr 30 , 61–67 (2000).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 6.

    Правин, П., Джордан, Ф. , Приами, С. и Морин, М. Дж. Роль грудного вскармливания в иммунной системе младенца: системный взгляд на микробиом кишечника. Микробиом 3 , 41 (2015).

    Артикул
    PubMed Central

    Google ученый

  • 7.

    Томкович С. и Джобин С. Микробиота и иммунные реакции хозяина: отношения любви-ненависти. Иммунология 147 , 1–10 (2016).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 8.

    Дутта, С., Ганеш, М., Рэй, П. и Наранг, А. Колонизация кишечника у младенцев с очень низкой массой тела при рождении в первую неделю жизни. Индийский педиатр 51 , 807–809 (2014).

    Артикул
    PubMed Central

    Google ученый

  • 10.

    Чу, Д. М. и др. . Созревание структуры и функции сообщества микробиома младенца во многих участках тела и в зависимости от способа доставки. Nat Med 23 , 314–326 (2017).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 11.

    Новрузян, Ф.L., Wold, A. E. и Adlerberth, I. Штаммы Escherichia coli, принадлежащие к филогенетической группе B2, обладают превосходной способностью сохраняться в микрофлоре кишечника младенцев. J Infect Dis 191 , 1078–1083 (2005).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 12.

    Putze, J. et al. . Генетическая структура и распределение геномного острова колибактина среди членов семейства Enterobacteriaceae. Infect Immun 77 , 4696–4703 (2009).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 13.

    Nowrouzian, F. L. & Oswald, E. Штаммы Escherichia coli, способные к длительной персистенции в кишечной микробиоте, несут потенциально генотоксичный островок pks. Microb Pathog 53 , 180–182 (2012).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 15.

    Dejea, C.M. et al. . Пациенты с семейным аденоматозным полипозом содержат биопленки толстой кишки, содержащие онкогенные бактерии. Наука 359 , 592–597 (2018).

    ADS
    CAS
    Статья
    PubMed Central

    Google ученый

  • 16.

    Куэвас-Рамос, Г. и др. . Escherichia coli вызывает повреждение ДНК in vivo и запускает геномную нестабильность в клетках млекопитающих. Proc Natl Acad Sci USA 107 , 11537–11542 (2010).

    ADS
    CAS
    Статья
    PubMed Central

    Google ученый

  • 17.

    Чен, Ю.-Т. и др. . Распространенность и характеристика клинических изолятов Klebsiella pneumoniae, положительных по кластеру генов генотоксина pks, на Тайване. Научный сотрудник 7 , 43120 (2017).

    ADS
    CAS
    Статья
    PubMed Central

    Google ученый

  • 18.

    Струве К., и др. . Картирование эволюции гипервирулентной Klebsiella pneumoniae. МБио 6 , e00630 (2015).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 19.

    Lai, Y. -C. и др. . Генотоксическая Klebsiella pneumoniae на Тайване. PLoS ONE 9 , e96292 (2014).

    ADS
    Статья
    PubMed Central

    Google ученый

  • 20.

    Paczosa, M. K. & Mecsas, J. Klebsiella pneumoniae: переход в наступление с сильной защитой. Microbiol Mol Biol Rev 80 , 629–661 (2016).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 21.

    Regueiro, V., Campos, M. A., Pons, J., Albertí, S. & Bengoechea, J. A. Поглощение полисахарида капсулы Klebsiella pneumoniae вызывает воспалительную реакцию эпителиальных клеток дыхательных путей человека. Microbiology (Reading, Engl) 152 , 555–566 (2006).

    CAS
    Статья

    Google ученый

  • 23.

    Chen, W., Liu, F., Ling, Z., Tong, X. & Xiang, C. Просвет кишечника человека и микробиота слизистой оболочки у пациентов с колоректальным раком. PLoS ONE 7 , e39743 (2012).

    ADS
    CAS
    Статья
    PubMed Central

    Google ученый

  • 24.

    Каакуш Н.О. и др. . Микробный дисбактериоз у педиатрических больных с болезнью Крона. J Clin Microbiol 50 , 3258–3266 (2012).

    Артикул
    PubMed Central

    Google ученый

  • 26.

    Lau, H.Y., Huffnagle, G. B. & Moore, T.A. Факторы хозяина и микробиоты, которые контролируют колонизацию слизистой оболочки Klebsiella pneumoniae у мышей. Микробы заражают 10 , 1283–1290 (2008).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 27.

    Zhang, C. et al. .Удаление клеток Панета в присутствии Klebsiella pneumoniae вызывает некротизирующий энтероколит (NEC) -подобное повреждение в тонкой кишке незрелых мышей. Dis Model Mech 5 , 522–532 (2012).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 28.

    Dubois, D. et al. . ClbP является прототипом подгруппы пептидаз, участвующей в биосинтезе нерибосомных пептидов. J Biol Chem 286 , 35562–35570 (2011).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 29.

    Brotherton, C. A. & Balskus, E. P. Механизм устойчивости к пролекарствам участвует в биосинтезе колибактина и цитотоксичности. J Am Chem Soc 135 , 3359–3362 (2013).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 31.

    Добблер, П. Т. и др. . Низкое микробное разнообразие и аномальная микробная сукцессия связаны с некротическим энтероколитом у недоношенных детей. Front Microbiol 8 , 2243 (2017).

    Артикул
    PubMed Central

    Google ученый

  • 32.

    Denning, N.-L. & Prince, J. M. Дисбактериоз кишечника новорожденных при некротическом энтероколите. Мол Мед 24 , 4 (2018).

    Артикул
    PubMed Central

    Google ученый

  • 34.

    Glocker, E.-O. и др. . Воспалительное заболевание кишечника и мутации, влияющие на рецептор интерлейкина-10. N Engl J Med 361 , 2033–2045 (2009).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 35.

    Моран, К. Дж. и др. . Полиморфизм IL-10R связан с очень ранним язвенным колитом. Воспаление кишечника 19 , 115–123 (2013).

    Артикул
    PubMed Central

    Google ученый

  • 37.

    Ли, И.-А. И Ким, Д.-Х. Klebsiella pneumoniae увеличивает риск воспаления и колита на мышиной модели кишечного заболевания кишечника. Scand J Gastroenterol 46 , 684–693 (2011).

    CAS
    Статья

    Google ученый

  • 38.

    McCafferty, J. et al. . Стохастические изменения с течением времени, а не эффекты основателя, управляют эффектами клетки в сборке микробного сообщества в модели мыши. ISME J 7 , 2116–2125 (2013).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 39.

    Atarashi, K. et al . Внематочная колонизация ротовыми бактериями в кишечнике вызывает индукцию клеток Th2 и воспаление. Наука 358 , 359–365 (2017).

    ADS
    CAS
    Статья
    PubMed Central

    Google ученый

  • 40.

    Mirpuri, J. et al. . IgA, специфичный для протеобактерий, регулирует созревание кишечной микробиоты. Кишечные микробы 5 , 28–39 (2014).

    Артикул
    PubMed Central

    Google ученый

  • 41.

    Dalmasso, G., Cougnoux, A., Delmas, J., Darfeuille-Michaud, A.И Боннет Р. Бактериальный генотоксин колибактин способствует росту опухоли толстой кишки, изменяя микроокружение опухоли. Кишечные микробы 5 , 675–680 (2014).

    Артикул
    PubMed Central

    Google ученый

  • 42.

    Bossuet-Greif, N. et al . Escherichia coli ClbS — это белок устойчивости к колибактину. Mol Microbiol 99 , 897–908 (2016).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 43.

    Tripathi, P. et al. . Clbs — это циклопропангидролаза, которая придает устойчивость к колибактину. J Am Chem Soc 139 , 17719–17722 (2017).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 45.

    Муса, Дж. Дж., Ньюсом, Р. К., Янг, Ю., Джобин, С. и Брунер, С. Д. ClbM — это универсальный катион-беспорядочный переносчик MATE, обнаруженный в кластере биосинтетических генов колибактина. Biochem Biophys Res Commun 482 , 1233–1239 (2017).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 46.

    Мартин, П. и др. . Взаимодействие между сидерофорами и путями биосинтеза генотоксина колибактина у Escherichia coli. PLoS Pathog 9 , e1003437 (2013).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 47.

    Lu, M.-C. и др. . Колибактин способствует гипервирулентности pks + K1 CC23 Klebsiella pneumoniae при инфекциях менингита мышей. Front Cell Infect Microbiol 7 , 103 (2017).

    PubMed
    PubMed Central

    Google ученый

  • 48.

    Розен, Д. А. и др. . Klebsiella pneumoniae FimK способствует вирулентности при пневмонии мышей. J Infect Dis 213 , 649–658 (2016).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 49.

    Паласиос, М., Броберг, К. А., Уолкер, К. А. и Миллер, В. Л. Случайная мутация выявляет серьезный дефект вирулентности мутанта aKlebsiella pneumoniae fepB. мСфера 2 (2017).

  • 50.

    Клиффорд Р.Дж. и др. . Обнаружение бактериальной 16S рРНК и идентификация четырех клинически важных бактерий с помощью ПЦР в реальном времени. PLoS ONE 7 , e48558 (2012).

    ADS
    CAS
    Статья
    PubMed Central

    Google ученый

  • 51.

    Liu, Y. et al. . ПЦР-определение Klebsiella pneumoniae в детской смеси на основе внутреннего транскрибируемого спейсера 16S – 23S. Int J Food Microbiol 125 , 230–235 (2008).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 53.

    Джолли, К. А., Брей, Дж. Э. и Мэйден, М. С. Дж. Геномика бактериальной популяции с открытым доступом: программное обеспечение BIGSdb, веб-сайт PubMLST.org и их приложения. [версия 1; судей: 2 утверждено]. Wellcome Open Res. 3 , 124 (2018).

    Артикул
    PubMed Central

    Google ученый

  • 54.

    Стаден Р., Бил К. Ф. и Бонфилд Дж. К. Пакет Стадена, 1998. Методы Mol Biol 132 , 115–130 (2000).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 55.

    Бертани Г. Исследования по лизогенезу. I. Способ высвобождения фага лизогенными Escherichia coli. J Бактериол 62 , 293–300 (1951).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 56.

    Wang, S. et al. . Векторы вакцины против сальмонелл, демонстрирующие замедленный синтез антигена in vivo , для повышения иммуногенности. Infect Immun 78 , 3969–3980 (2010).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 57.

    Sun, W., Sanapala, S. , Rahav, H. & Curtiss, R. Пероральное введение рекомбинантного аттенуированного штамма Yersinia pseudotuberculosis вызывает защитный иммунитет против чумы. Vaccine 33 , 6727–6735 (2015).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 58.

    Sun, X., Threadgill, D. и Jobin, C. Campylobacter jejuni индуцирует колит посредством активации у млекопитающих-мишеней передачи сигналов рапамицина. Гастроэнтерология 142 , 86–95.e5 (2012).

    CAS
    Статья
    PubMed Central

    Google ученый

  • 59.

    Karrasch, T., Kim, J.-S., Muhlbauer, M., Magness, ST & Jobin, C. Gnotobiotic IL-10 — / -; NF-kappa B (EGFP) мыши обнаруживают критическая роль передачи сигналов TLR / NF-kappa B при колите, индуцированном комменсальными бактериями. J Immunol 178 , 6522–6532 (2007).

    CAS
    Статья
    PubMed Central

    Google ученый

  • Инфекция Klebsiella Pneumoniae: симптомы, причины и лечение

    Klebsiella pneumoniae ( K. pneumoniae ) — это бактерии, которые обычно обитают в кишечнике и кале.

    Эти бактерии безвредны, когда они находятся в вашем кишечнике. Но если они распространятся на другую часть вашего тела, они могут вызвать серьезные инфекции.Риск выше, если вы заболели.

    K. pneumoniae может заразить вас:

    Местоположение вашей инфекции будет определять ваши симптомы и лечение. Как правило, здоровые люди не заражаются K. pneumoniae . У вас больше шансов получить его, если у вас слабая иммунная система из-за заболевания или длительного приема антибиотиков.

    Инфекции K. pneumoniae лечат антибиотиками, но у некоторых штаммов развилась лекарственная устойчивость.Эти инфекции очень трудно лечить обычными антибиотиками.

    Инфекция Klebsiella вызывается бактериями K. pneumoniae . Это случается при прямом попадании в организм K. pneumoniae . Обычно это происходит из-за личного контакта.

    В организме бактерии могут выжить благодаря защитным силам иммунной системы и вызвать инфекцию.

    Поскольку K. pneumoniae может инфицировать разные части тела, он может вызывать различные типы инфекций.

    У каждой инфекции разные симптомы.

    Пневмония

    K. pneumoniae часто вызывает бактериальную пневмонию или инфекцию легких. Это происходит, когда бактерии попадают в дыхательные пути.

    Внебольничная пневмония возникает, если вы заразились в общественных местах, например в торговом центре или метро. Госпитальная пневмония возникает, если вы заразились в больнице или доме престарелых.

    В западных странах K. pneumoniae вызывает от 3 до 5 процентов внебольничных пневмоний.На его долю также приходится 11,8% случаев внутрибольничной пневмонии во всем мире.

    Симптомы пневмонии включают:

    Инфекция мочевыводящих путей

    Попадание K. pneumoniae в ваши мочевыводящие пути может вызвать инфекцию мочевыводящих путей (ИМП). Мочевыводящие пути включают уретру, мочевой пузырь, мочеточники и почки.

    Klebsiella ИМП возникают, когда бактерии попадают в мочевыводящие пути. Это также может произойти после длительного использования мочевого катетера.

    Как правило, инфекционные заболевания мочевых путей у пожилых женщин вызывает K. pneumoniae .

    ИМП не всегда вызывают симптомы. Если у вас есть симптомы, вы можете испытать:

    • частые позывы к мочеиспусканию
    • боль и жжение при мочеиспускании
    • кровянистая или мутная моча
    • моча с сильным запахом
    • отхождение небольшого количества мочи
    • боль в спине или область таза
    • дискомфорт в нижней части живота

    Если у вас ИМП в почках, у вас может быть:

    Инфекция кожи или мягких тканей

    Если K. pneumoniae проникает через разрыв кожи и может инфицировать кожу или мягкие ткани. Обычно это случается с ранами, полученными в результате травмы или хирургического вмешательства.

    K. pneumoniae раневые инфекции включают:

    В зависимости от типа инфекции вы можете испытать:

    Менингит

    В редких случаях K. pneumoniae может вызывать бактериальный менингит или воспаление покрывающих мембран. головной и спинной мозг. Это происходит, когда бактерии заражают жидкость вокруг головного и спинного мозга.

    Большинство случаев K . pneumoniae менингит случается в больницах.

    Обычно менингит вызывает внезапное начало:

    Другие симптомы могут включать:

    Эндофтальмит

    Если K. pneumoniae находится в крови, он может распространиться в глаза и вызвать эндофтальмит. Это инфекция, которая вызывает воспаление в белке глаза.

    Симптомы могут включать:

    Пиогенный абсцесс печени

    Часто K. pneumoniae поражает печень. Это может вызвать гнойный абсцесс печени или образование, заполненное гноем.

    K. pneumoniae абсцессы печени обычно поражают людей, страдающих диабетом или длительно принимающих антибиотики.

    Общие симптомы включают:

    Инфекция крови

    Если K. pneumoniae попадает в вашу кровь, это может вызвать бактериемию или присутствие бактерий в крови.

    При первичной бактериемии K. pneumoniae напрямую заражает ваш кровоток.При вторичной бактериемии K. pneumoniae попадает в вашу кровь из-за инфекции в другом месте вашего тела.

    По оценкам одного исследования, около 50 процентов из инфекций крови Klebsiella происходят от инфекции Klebsiella в легких.

    Симптомы обычно возникают внезапно. Это может включать:

    Бактериемию необходимо лечить немедленно. Если не лечить, бактериемия может стать опасной для жизни и перерасти в сепсис.

    Скорая медицинская помощь

    Бактериемия — это неотложная медицинская помощь. Обратитесь в ближайшее отделение неотложной помощи или позвоните в службу 911 или в местную службу экстренной помощи, если вы подозреваете, что она у вас есть. Ваш прогноз будет лучше, если вы начнете лечение раньше. Это также снизит риск опасных для жизни осложнений.

    Вероятность получить K. pneumoniae выше, если у вас ослабленная иммунная система.

    Факторы риска заражения включают:

    Многие из этих состояний могут подавлять вашу иммунную систему, особенно если их не лечить.

    К.pneumoniae передается от человека к человеку. Это может произойти, если вы прикоснетесь к инфицированному.

    Незараженный человек также может переносить бактерии от одного человека к другому.

    Кроме того, бактерии могут заражать медицинские объекты, например:

    K. pneumoniae не может передаваться по воздуху.

    Врач может провести различные тесты для диагностики инфекции Klebsiella .

    Тесты будут зависеть от ваших симптомов. Это может включать:

    • Физический осмотр. Если у вас есть рана, врач поищет признаки инфекции. Они также могут осмотреть ваш глаз, если у вас есть симптомы, связанные с глазами.
    • Пробы жидкости. Ваш врач может взять образцы крови, слизи, мочи или спинномозговой жидкости. Образцы будут проверены на наличие бактерий.
    • Визуальные тесты. Если врач подозревает пневмонию, он сделает рентген грудной клетки или ПЭТ, чтобы исследовать ваши легкие. Если врач считает, что у вас абсцесс печени, он может сделать УЗИ или компьютерную томографию.

    Если вы используете вентилятор или катетер, ваш врач может проверить эти объекты на наличие K. pneumoniae .

    K. pneumoniae инфекции лечат антибиотиками. Однако бактерии бывает трудно лечить. Некоторые штаммы обладают высокой устойчивостью к антибиотикам.

    Если у вас лекарственно-устойчивая инфекция, ваш врач назначит лабораторные анализы, чтобы определить, какой антибиотик подойдет лучше всего.

    Всегда следуйте указаниям врача. Если вы перестанете принимать антибиотики слишком рано, инфекция может вернуться.

    Если вы заметили какие-либо признаки инфекции, обратитесь к врачу. Если у вас внезапно поднялась температура или вы не можете дышать, немедленно обратитесь за медицинской помощью. Вы можете записаться на прием к лечащему врачу в вашем районе, используя наш инструмент Healthline FindCare.

    Инфекция Klebsiella может быстро распространяться по организму, поэтому важно обращаться за помощью.

    Поскольку K. pneumoniae передается от человека к человеку, лучший способ предотвратить заражение — это часто мыть руки.

    Соблюдайте правила гигиены рук, чтобы микробы не распространялись. Вы должны мыть руки:

    • перед тем, как дотронуться до глаз, носа или рта
    • до и после приготовления или приема пищи
    • до и после смены повязки на рану
    • после посещения туалета
    • после кашля или чихания

    Если вы находитесь в больнице, персонал также должен носить перчатки и халаты при контакте с другими людьми с инфекцией Klebsiella . Им также следует мыть руки после прикосновения к больничным поверхностям.

    Если вы подвержены риску заражения, врач может объяснить другие способы обеспечения безопасности.

    Прогнозы и выздоровление сильно различаются. Это зависит от нескольких факторов, включая ваш:

    • возраст
    • состояние здоровья
    • штамм K. pneumoniae
    • тип инфекции
    • тяжесть инфекции

    В некоторых случаях инфекция может вызвать длительные последствия.Например, пневмония Klebsiella может необратимо нарушать функцию легких.

    Ваш прогноз лучше, если вы начнете лечение на ранней стадии. Это также снизит риск опасных для жизни осложнений.

    Восстановление может занять от нескольких недель до нескольких месяцев.

    В это время примите все антибиотики и посетите контрольные приемы.

    Klebsiella pneumoniae ( K. pneumoniae ) обычно безвредны. Бактерии живут в кишечнике и кале, но могут быть опасны в других частях тела.

    Klebsiella может вызывать серьезные инфекции легких, мочевого пузыря, мозга, печени, глаз, крови и ран. Ваши симптомы зависят от типа инфекции.

    Инфекция передается от человека к человеку. Ваш риск выше, если вы заболели. Как правило, здоровые люди не заражаются Klebsiella .

    Если вы получили K. pneumoniae , вам потребуются антибиотики. Некоторые штаммы устойчивы к лекарствам, но ваш врач может определить, какой антибиотик подойдет лучше всего.Восстановление может занять несколько месяцев, но раннее лечение улучшит ваш прогноз.

    Молекулярная характеристика изолятов Klebsiella pneumoniae в образцах стула амбулаторных больных в дозорных больницах Пекин, Китай, 2010–2015 гг. Кишечные патогены

  • 1.

    Podschun R, Ullmann U. Klebsiella spp. в качестве внутрибольничных возбудителей: эпидемиология, таксономия, методы типирования, факторы патогенности. Clin Microbiol Rev.1998; 11: 589–603 (Epub 1998/10/10) .

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 2.

    Guerin F, Le Bouguenec C, Gilquin J, Haddad F, Goldstein FW. Кровавая диарея, вызванная Klebsiella pneumoniae : новый механизм бактериальной вирулентности? Clin Infect Dis. 1998; 27: 648–9 (Epub 1998/10/14) .

    CAS
    Статья
    PubMed

    Google ученый

  • 3.

    Gassama-Sow ​​A, Diallo MH, Wane AA, Seck A, Samb-Ba B, Sow PS, Aidara-Kane A. Генетические детерминанты устойчивости к антибиотикам при диарее Klebsiella pneumoniae подвидов ozaenae: возникающий энтеропатоген в Сенегале.Clin Infect Dis. 2010; 50: 453–5 (Epub 2010/01/13) .

    CAS
    Статья
    PubMed

    Google ученый

  • 5.

    Yu J, Jing H, Lai S, Xu W, Li M, Wu J, Liu W, Yuan Z, Chen Y, Zhao S, Wang X, Zhao Z, Ran L, Wu S, Klena JD, Feng L, Li F, Ye X, Qiu Y, Yu H, Li Z, Yang W. Этиология диареи у детей в возрасте до пяти лет в Китае: результаты пятилетнего наблюдения. J Infect. 2015; 71: 19–27 (Epub 2015/03/11) .

    Артикул
    PubMed
    PubMed Central

    Google ученый

  • 7.

    Рибо Э.М., Фэйр М.А., Готом Р., Камерон Д.Н., Хантер С.Б., Сваминатан Б., Баррет Т.Дж. Стандартизация протоколов гель-электрофореза в импульсном поле для подтипа Escherichia coli O157: H7, Salmonella и Shigella для PulseNet. Foodborne Pathog Dis. 2006; 3: 59–67 (Epub 2006/04/11) .

    CAS
    Статья
    PubMed

    Google ученый

  • 8.

    Tseng IL, Liu YM, Wang SJ, Yeh HY, Hsieh CL, Lu HL, Tseng YC, Mu JJ. Появление карбапенемазы, продуцирующей Klebsiella pneumonia , и распространение KPC-2 и KPC-17 на Тайване: общенациональное исследование с 2011 по 2013 год. PLoS ONE. 2015; 10: e0138471 (Epub 2015/09/19) .

    Артикул
    PubMed
    PubMed Central

    Google ученый

  • 9.

    Cheng L, Cao XL, Zhang ZF, Ning MZ, Xu XJ, Zhou W, Chen JH, Zhang JH, Shen H, Zhang K.Клональное распространение KPC-2, продуцирующего клон Klebsiella pneumoniae ST11 с высокой распространенностью oqxAB и rmtB в высокоспециализированной больнице в Китае: результаты за трехлетний период. Анн Клин Микробиол Антимикроб. 2016; 15: 1 (Epub 2016.01.21) .

    Артикул
    PubMed
    PubMed Central

    Google ученый

  • 10.

    Diancourt L, Passet V, Verhoef J, Grimont PA, Brisse S. Мультилокусное типирование последовательностей нозокомиальных изолятов Klebsiella pneumoniae . J Clin Microbiol. 2005; 43: 4178–82 (Epub 2005/08/06) .

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 11.

    Ли Дж. К., Ли Нью-Йорк, Ли ХК, Хуанг У.С., Цуй К.С., Чанг С.М., Ли С.К., Чен П.Л., Ву Си-Джей, Сюэ ПР, Ко-WC. Клинические характеристики уросепсиса, вызванного продуцирующей бета-лактамазой расширенного спектра действия Escherichia coli или Klebsiella pneumonia , и их появление в обществе.J Microbiol Immunol Infect. 2012; 45: 127–33 (Epub 2011/11/02) .

    CAS
    Статья
    PubMed

    Google ученый

  • 12.

    Qi Y, Wei Z, Ji S, Du X, Shen P, Yu Y. ST11, доминирующий клон KPC-продуцента Klebsiella pneumoniae в Китае. J Antimicrob Chemother. 2011; 66: 307–12 (Epub 2010/12/07) .

    CAS
    Статья
    PubMed

    Google ученый

  • 13.

    Ито Р., Шиндо Й, Кобаяси Д., Андо М., Джин В., Вачино Дж, Ямада К., Кимура К., Яги Т., Хасегава И., Аракава Ю. Молекулярно-эпидемиологические характеристики Klebsiella pneumoniae , ассоциированного с бактериемией у пациентов с пневмонией. J Clin Microbiol. 2015; 53: 879–86 (Epub 2015/01/09) .

    Артикул
    PubMed
    PubMed Central

    Google ученый

  • 14.

    Yu WL, Ko WC, Cheng KC, Lee HC, Ke DS, Lee CC, Fung CP, Chuang YC.Связь между генами rmpA и magA и клинические синдромы, вызываемые Klebsiella pneumoniae на Тайване. Clin Infect Dis. 2006; 42: 1351–8 (Epub 2006/04/19) .

    CAS
    Статья
    PubMed

    Google ученый

  • 15.

    Yu VL, Hansen DS, Ko WC, Sagnimeni A, Klugman KP, von Gottberg A, Goossens H, Wagener MM, Benedi VJ. Характеристики вирулентности Klebsiella и клинические проявления K.pneumoniae инфекции кровотока. Emerg Infect Dis. 2007; 13: 986–93 (Epub 2008/01/25) .

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 16.

    Патерсон Д.Л., Ко В.К., фон Готтберг А., Мохапатра С., Каселлас Дж. М., Гуссенс Х., Мулазимоглу Л., Тренхольм Г., Клугман К. П., Бономо Р. А., Райс Л. Б., Вагенер М. М., Маккормак Дж. Г., Ю. В. Л.. Международное проспективное исследование бактериемии Klebsiella pneumoniae : последствия продукции бета-лактамаз расширенного спектра при внутрибольничных инфекциях. Ann Intern Med. 2004; 140: 26–32 (Epub 2004/01/07) .

    Артикул
    PubMed

    Google ученый

  • 17.

    Ливермор DM. Современная эпидемиология и растущая устойчивость грамотрицательных патогенов. Kor J Intern Med. 2012; 27: 128–42 (Epub 2012/06/19) .

    CAS
    Статья

    Google ученый

  • 18.

    Кантон Р., Коке TM, Бакеро Ф. Мультирезистентные грамотрицательные бациллы: от эпидемий к эндемикам.Curr Opin Infect Dis. 2003; 16: 315–25 (Epub 2003/07/16) .

    Артикул
    PubMed

    Google ученый

  • Клинико-патологические данные у детей, умерших в результате инфекции кровотока Klebsiella pneumoniae

    Основные моменты

    Klebsiella pneumoniae Инфекции кровотока представляют собой серьезную клиническую проблему у госпитализированных детей

    опубликованные исследования в области результатов аутопсии

    Наша статья привносит другое измерение в понимание Enterobacteriaceae инфекций у детей

    Раннее обнаружение образования биопленок в образцах тканей может указывать на суб- оптимальные ответы на антибиотики

    Необходимы дополнительные исследования для понимания молекулярных механизмов образования биопленок, связанных с Klebsiella pneumoniae

    Реферат

    Предпосылки

    Klebsiella pneum oniae Инфекция кровотока (KPBSI) тесно связана с госпитализацией и может привести к значительной заболеваемости и смертности. Данных, описывающих результаты вскрытия KPBSI у детей, мало.

    Методы

    Мы провели ретроспективный обзор клинико-патологических данных у детей, умерших во время курса KPBSI в детской больнице в Кейптауне, Южная Африка.

    Результаты

    Пятнадцать госпитализированных детей, умерших и перенесших вскрытие, были включены в этот анализ. Их средний возраст (межквартильный диапазон, IQR) составлял 4 (1-22) месяца, 2 (20%) были ВИЧ-инфицированными и 10 (67%) имели умеренно или сильно пониженный вес.Среднее время до смерти от момента положительного посева крови составляло 1 (IQR 0–5) день. Заметными результатами аутопсии во многих случаях были полиорганная недостаточность, вызванная сепсисом, включая инволюцию тимуса, эрозии пищевода, кровоизлияние в надпочечники, острый некроз канальцев и разрушение паренхимы легких. Другие гистологические находки включали диссеминированную внутрисосудистую коагулопатию, некротизирующее воспаление во многих органах; и у четырех из пяти детей образование биопленок.

    Заключение

    KPBSI может вызывать обширную некротическую ткань.

    Ключевые слова

    Klebsiella pneumoniae Инфекция кровотока

    Дети

    Африка

    Вскрытие / вскрытие

    Рекомендуемые статьиЦитирующие статьи (0)

    © 2019 Авторы. Опубликовано Elsevier Ltd от имени Британской ассоциации инфекций.

    Рекомендуемые статьи

    Ссылки на статьи

    Клебсиелла — обзор | Темы ScienceDirect

    Клинические проявления

    Klebsiella spp . являются важными условно-патогенными микроорганизмами у детей, вызывающими широкий спектр инфекций, включая ИБС, связанные со здоровьем и общиной; инфекции центральной нервной системы (ЦНС), дыхательные пути, мочевые пути, опорно-двигательный аппарат, и брюшная полость; глубокие абсцессы и инфекции послеоперационных, травматических и ожоговых ран. Примерно 75% BSI связаны со здравоохранением. 16–24 Вспышки в неонатальных отделениях вызывают серьезную озабоченность. 25 Неонатальные инфекции включают BSI, менингит, абсцесс мозга, конъюнктивит, абсцесс печени, эндокардит, пневмонию, некротический фасциит, артрит, остеомиелит, инфекцию мочевыводящих путей (UTI) и некротический энтероколит (NEC). 26–32 Клинические проявления инфекции не отличаются от таковых у других грамотрицательных бацилл. Хотя Escherichia coli является наиболее частой причиной ИМП, Klebsiella и Proteus spp . также являются распространенными микроорганизмами Enterobacteriaceae, связанными с ИМП. 33

    Грамотрицательные организмы составляют более 50% ИМТ у детей. Во время 6-летнего проспективного исследования грамотрицательных BSI в педиатрическом медицинском центре третичного уровня в Израиле, K.pneumoniae был наиболее часто идентифицируемым патогеном, составляющим 26% (109 из 419) изолятов. 19 В обзоре 57 случаев ИМТ у детей, вызванного K. pneumoniae , 67% были моложе 12 месяцев, и у большинства было по крайней мере одно основное заболевание, включая аномалии желудочно-кишечного тракта у 56%, центральный венозный катетер. у 35%, нейтропения у 25% и патология мочевыводящих путей у 16%. 34

    Проект по надзору и контролю за патогенами эпидемиологической важности, основанный в Университете Содружества Вирджинии в Ричмонде, предоставил важные данные для выявления преобладающих патогенов, ответственных за связанные со здоровьем BSIs у детей. 35 Хотя грамположительные организмы, особенно коагулазонегативные виды Staphylococcus spp., Составляли более 50% изолятов, Candida spp . составили 9,3%, а Klebsiella spp . На , Enterobacter spp. И Escherichia coli приходилось 5,8%, 5% и 5% изолятов соответственно.

    Другие состояния, связанные с Klebsiella spp. BSI в детстве включает недоношенность, предшествующее воздействие антибиотиков, предшествующий ротавирусный гастроэнтерит, процедуру Касаи при атрезии желчных путей, злокачественные новообразования, послеоперационный статус, ожоги, множественные травмы, синдром приобретенного иммунодефицита, нарушения гранулоцитов, гомозиготную серповидно-клеточную анемию, трансплантацию твердых органов, послеоперационный период. после спленэктомии, системной красной волчанки и дефицита β1 цепи рецептора интерлейкина-12. 19,35–41 Загрязненные растворы для внутривенного введения также были идентифицированы как источник Klebsiella spp. BSI. 42

    Общий коэффициент смертности для Klebsiella spp. BSI составляет около 11%, а уровень смертности от BSI, связанного со здравоохранением, составляет 14,5%. 19,35 Повышенный уровень смертности в значительной степени связан с острым лейкозом, нейтропенией, инфекциями, связанными со здоровьем (HAI), и предшествующей терапией кортикостероидами.

    Цитотоксин-продуцентные штаммы K.oxytoca были замешаны в антибиотико-ассоциированном геморрагическом колите. 14,43,44 Клиническим проявлениям боли в животе и кровавой диареи обычно предшествует лечение антибиотиками с β-лактамным агентом. Колит обычно сегментарный и локализуется преимущественно в правой толстой кишке. Прекращение приема противомикробного агента и поддерживающая терапия обычно приводят к клиническому разрешению. Энтеротоксигенные и энтероагрегантные штаммы K. pneumoniae также были вовлечены в качестве причин детского гастроэнтерита. 45

    Raoultella spp. о них непоследовательно сообщалось как о колонизирующих бактериях желудочно-кишечного тракта госпитализированных новорожденных, а также как о возбудителях ИБС и пневмонии у взрослых. 46,47 R. planticola был выделен из мочи взрослых особей; раны, включая внутрибрюшной абсцесс, связанный с панкреатитом; и зараженные смеси для младенцев. 48–50 R. ornithinolytica был выделен из крови новорожденного с висцеральной гетеротаксией, функциональной аспленией и сложным врожденным пороком сердца с НЭК; от одного взрослого с гигантской кистой почек; а от другого — с синдромом кишечной лихорадки. 51–53

    R. ornithinolytica и R. planticola , по всей видимости, вызывает отравление скомброидных (гистаминовых) рыб. 8 Это состояние возникает после приема внутрь неправильно хранимой (> 20 ° C) скомброидной рыбы (например, тунца, махи-махи, скумбрии, скумбрии, сардины) и возникает в результате расщепления высоких концентраций гистидина на гистамин под действием бактериальных гистидиндекарбоксилаза. 51,53 Инкубационный период может составлять от 1 минуты до 3 часов. Клинические проявления могут включать заметное покраснение кожи (особенно лица, верхней части туловища и рук), головную боль, головокружение, спазмы в животе, рвоту, диарею, жжение во рту, крапивницу, генерализованный зуд и (редко) гипотензию и бронхоспазм.

    Новый механизм бактериальной вирулентности?

    648 Краткие отчеты CID 1998; 27 (сентябрь)

    9. Brown S, Becher J, Brady W. Лечение эктопаразитарных инфекций: обзор 15. Shelley WB, Shelley ED, Burmeister V. Колонизация Staphylococcus aureus-

    ция норы в норвежской эритродермической чесотке. Тематическое исследование

    англоязычной литературы, 1982–1992 гг. Clin Infect Dis 1995;

    Ятрогенная инфекция. J Am Acad Dermatol 1988; 19: 673–8.

    20 (приложение 1): S104–9.

    16. Гловер Р., Янг Л., Гольц Р. В.. Норвежская чесотка в приобретенном иммуноде —

    10. Мейнкинг Т.Л., Таплин Д. Безопасность перметрина по сравнению с линданом для лечения

    Синдром эффективности: сообщение о случае, приведшем к смерти от

    ассоциированной чесотки. Arch Dermatol 1996; 132: 959 — 62.

    сепсис [письмо]. J Am Acad Dermatol 1987; 16: 396–9.

    11. Franz TJ, Lehman PA, Franz SF, Guin JD. Сравнительный чрескожный

    17.Мейнкинг Т.Л., Таплин Д., Гермида Д.Л., Пардо Р., Кердель Ф.А. Обработка

    абсорбция линдана и перметрина. Arch Dermatol 1996; 132:

    чесотки с ивермектином. N Engl J Med 1995; 333: 26–30.

    901–5.

    18. Del Giudice P, Carles M, Couppie

    ´

    P, et al. Успешное лечение корок

    12. Первис Р.С., Тайринг С.К. Вспышка линдан-резистентной чесотки позволила успешно лечить

    (норвежская) чесотка ивермектином у двух пациентов с человеческим иммунодефицитом

    с применением 5% крема с перметрином.J Am Acad Dermatol 1991;

    Инфекция вирусом муно-дефицита [письмо]. BJ Dermatol 1996; 135:

    25: 1015–6.

    494–5.

    13. Соломон Б.А., Верхний С.Р., Карр Е.М., Шалита А.Р. Нейротоксическая реакция на

    19. Рейнтьес Р., Хук С. Смерти, связанные с ивермектином от чесотки [письмо].

    линдан у ВИЧ-инфицированного пациента. Новая проблема старого лекарства

    Lancet 1997; 350: 215–6.

    лем. J Fam Pract 1995; 40: 291 — 6.

    20.Diazgranados JA, Costa JL. Смертность после лечения ивермектином [письмо].

    14. Funkhouser ME, Omohundro C, Ross A, Berger TG. Управление

    Lancet 1997; 349: 1698.

    чесотка у пациентов с болезнью, вызванной вирусом иммунодефицита человека [письмо].

    21. Оркин М. Чесотка: что нового? Curr Probl Dermatol 1995; 22: 105–11.

    Arch Dermatol 1993; 129: 911 — 3.

    22. Фишман Х.С. Дерматит от крысиного клеща. Кутис 1988; 42: 414–6.

    Терапия была начата с цефтриаксона в / в 2 г / сут в течение 2 дней.

    Кровавая диарея, вызванная Klebsiella pneumoniae: состояние пациента

    быстро улучшилось, и лабораторная оценка

    Новый механизм бактериальной вирулентности?

    — гематологические показатели исправлены. В это время повторный посев кала

    был отрицательным на K. pneumoniae.

    Klebsiella pneumoniae и Klebsiella oxytoca, оба com-

    K. pneumoniae и K. oxytoca, оба комменсалы человека

    , передаваемые через желудочно-кишечный тракт человека, были зарегистрированы

    желудочно-кишечного тракта, иногда вызывают диарею у людей [1]. ].

    может быть случайной причиной диареи у людей [1]. Мы де-

    Некоторые из этих диарейных штаммов кодируют термостабильные или термостабильные

    пациента с кровавой диареей, вызванной K. pneumoniae.

    молабильный токсин [1], или уникальный цитотоксин, который вызывает округление

    66-летняя женщина поступила на оценку лихорадки

    клеток культуры ткани [2]. Однако роль этих токсинов в

    (температура 38,57 ° C), слабость и кровавый понос.Один

    патогенез диареи, связанной с клебсиеллой, не был прояснен за неделю до госпитализации, в последний день ее визита в Египет,

    ed. В этом изоляте не было обнаружено последовательностей, которые были

    , она получила неизвестный антибиотик для лечения внезапных

    , гомологичных генам энтеропатогенных штаммов E. coli, которые кодируют

    начало диареи и лихорадки. Применение антибиотика было прекращено на

    из-за термолабильных и термостабильных токсинов, которые производятся на

    на следующий день из-за генерализованного зуда и крапивницы.

    некоторые штаммы K. pneumoniae.

    При медицинском осмотре выявлены боли в животе и тошнота.

    Один из способов связи кишечных патогенов с кишечником

    Лабораторная оценка показала следующие значения: лейкоциты,

    клетки — это перестройка цитоскелета. Изолят K. pneumoniae

    3,5 1 10

    9

    / л; тромбоциты, 101 1 10

    9

    / л; и гемоглобин,

    проявлял свойства связывания с клетками HeLa (фигура 1A), а cy-

    13.0 г / дл. У нее не было ослабленного иммунитета, и у нее был ВИЧ

    , скелетные белки, такие как актин, накапливались в точке отрицательного результата

    . Культуры крови были отрицательными на бактерии. Microbio-

    логическая оценка стула была отрицательной на сальмонеллу, контакт шибактерии-хозяина (рисунок 1B). Было обнаружено, что изолят представляет собой

    гелл и видов Yersinia; энтеропатогенная кишечная палочка;

    отрицательный при тестировании на наличие последовательностей ДНК

    видов Campylobacter; и Clostridium difficile.Культура кала —

    кодирует факторы вирулентности, которые ранее приписывались

    культурам K. pneumoniae, которые были выделены в виде чистой культуры на

    патогенных штаммах E. coli, которые вызывают кровавую диарею.

    Среда Дригальского (лактозно-пурпурный кристалл) ; Diagnostic Pasteur,

    или дизентерийные синдромы (гены, кодирующие SLT-I и SLT-II, ipaH

    Marnes la Coquette, Франция) и были устойчивы к гену хлорамфени-

    ).

    col, сульфамиды и фторхинолоны.Оценка паразитов

    Способность связываться с культивируемыми эпителиальными клетками и способствовать развитию

    (Giardia lamblia, Entamoeba histolytica, Schistosoma man-

    , модификация цитоскелета была описана в энтеропато-

    soni) была отрицательной. Ни ротавирусы, ни аденовирусы не были обнаружены в генной E. coli (EPEC). Штаммы EPEC прикрепляются к кишечнику

    tected.

    слизистой оболочки и образуют резкое «прикрепление и стирание» (A–

    E) поражение [3, 4].Важные перестройки цитоскелета

    (цитоскелетные белки) наблюдаются под прикрепленными бактериями

    , включая актин [5]. Эти перестройки коррелируют с

    Перепечатки или переписка: д-р FW Goldstein, Service de Microbiologie

    наличие хромосомного локуса LEE (локус для энтероцита

    Me

    ´

    dicale, Fondation Ho

    ˆ

    pital Joseph, 185 rue Raymond Losserand, 75014

    effacement) и с геном eaeA, кодирующим интимин.Там

    Париж, Франция.

    не было обнаружено последовательностью в нашем изоляте, который был гомологичен

    Clinical Infectious Diseases 1998; 27: 648–9

    к гену EPEC eaeA или к гену, кодирующему адгезию

    q 1998 Американским обществом инфекционных болезней. Все права защищены.

    1058–4838 / 98 / 2703–0037 $ 03.00

    Штаммы EPEC клетки HeLa (ген bfpA). Одно объяснение для

    / 9c55 $$ se16 08-24-98 05:26:17 cidas UC: CID

    гостем 29 декабря 2011 г. http://cid.Oxfordjournals.org/Downloaded from

    Модель на животных для изучения кишечной колонизации Klebsiella pneumoniae и передачи от хозяина к хозяину

    Abstract

    Важным, но малоизученным аспектом жизненного цикла успешного патогена является хозяин. -узловая передача. Внутрибольничные инфекции (HAI), возникающие в результате передачи устойчивых к лекарствам патогенов, поражают сотни миллионов пациентов во всем мире. Klebsiella pneumoniae ( Kpn ), грамотрицательная бактерия, печально известна тем, что вызывает HAI, при этом многие из этих инфекций трудно поддаются лечению, поскольку Kpn приобрел множественную лекарственную устойчивость.Эпидемиологические исследования показывают, что передача Kpn от хозяина к хозяину требует тесного контакта и обычно происходит фекально-оральным путем. Здесь мы описываем модель на мышах, которую можно использовать для изучения колонизации слизистой оболочки (ротоглотки и желудочно-кишечного тракта [GI]), выделения с фекалиями и передачи Kpn фекально-оральным путем. Используя пероральный путь инокуляции и выделение фекалий в качестве маркера колонизации GI, мы показали, что Kpn может бессимптомно колонизировать желудочно-кишечный тракт иммунокомпетентных мышей и модифицирует микробиоту GI хозяина.Плотность колонизации в желудочно-кишечном тракте и уровни выделения с фекалиями различались среди протестированных клинических изолятов. Гипервирулентный изолят Kpn был способен перемещаться из желудочно-кишечного тракта и вызывать инфекцию печени, имитирующую путь заражения человека. Экспрессия капсулы требовалась для колонизации и, в свою очередь, для устойчивого отторжения. Кроме того, мыши-носители Kpn были способны передавать инфекции неинфицированным сожительствующим мышам. Наконец, лечение антибиотиками привело к изменениям в микробиоте хозяина и развитию временного фенотипа суперседдера, что повысило эффективность передачи. Таким образом, эту модель можно использовать для определения вклада факторов хозяина и бактерий в распространение Kpn .

    Введение

    Передача патогенов от хозяина к хозяину является основным источником внутрибольничных инфекций, которые считаются серьезной угрозой для здоровья пациента, а также значительным бременем для системы здравоохранения (1, 2). Только в США на внутрибольничные инфекции (HAI) приходится около 100 000 смертей (3). Основной причиной этих внутрибольничных инфекций и множественных вспышек в больницах по всему миру является Klebsiella pneumoniae ( K.pneumoniae ; Kpn ), член семейства Enterobacteriaceae , который часто вызывает пневмонию, бактериемию, гнойные абсцессы печени и инфекции мочевыводящих путей (4), причем большинство этих инфекций обычно возникает у пациентов с ослабленным иммунитетом. С повсеместным использованием антибиотиков изоляты Kpn приобрели широкую лекарственную устойчивость, а некоторые из них теперь даже считаются устойчивыми к лекарственным средствам, что делает вызываемые ими инфекции чрезвычайно трудными для лечения (5-7). По этой причине ВОЗ перечисляет Klebsiella pneumoniae как критический патоген, для которого срочно требуются новые антибиотики и другие методы лечения для решения этой растущей проблемы здравоохранения (8, 9). Дальнейшим обострением лечения инфекций Kpn является недавняя идентификация изолятов, названных «гипервирулентными K. pneumoniae » ( hvKP ), которые могут вызывать заболевания, такие как внебольничные гнойные абсцессы печени у здоровых людей (10–12). Пациенты, выздоравливающие после инфекции hvKP , часто страдают от постинфекционных осложнений, которые могут привести к потере конечности или зрения (13-15).Эти штаммы, первоначально изолированные в Азиатско-Тихоокеанском регионе, с тех пор распространились по всему миру (10).

    В естественной среде первыми местами колонизации слизистой оболочки обычно являются ротоглотка и желудочно-кишечный тракт (16, 17). Эти события колонизации обычно протекают бессимптомно (18). Однако при определенных обстоятельствах Kpn может получить доступ к другим стерильным сайтам в хозяине и вызвать заболевание. Эпидемиологические данные предполагают, что многие пациенты в больницах являются носителями Kpn в желудочно-кишечном тракте с корреляцией между носительством Kpn и последующим заболеванием от того же изолята (19-21).Помимо пациентов, персонал больницы также может быть бессимптомным носителем Kpn , и эти молчащие носители действуют как резервуар, из которого Kpn может проявлять болезнь у одного и того же хозяина или действовать как источник передачи новому хозяину (18, 22). -24).

    Устойчивость к колонизации, обеспечиваемая микробиотой хозяина, играет решающую роль в блокировании колонизации патогенами. Однако использование антибиотиков снижает микробное разнообразие в желудочно-кишечном тракте, что потенциально позволяет Kpn легко колонизировать хозяина.Исследования также показывают, что лечение мышей антибиотиками предрасполагает их к состоянию «супершеддера», когда они выделяют резидентные патогены кишечника в большем количестве, что усиливает передачу от хозяина к хозяину (25, 26). Однако неясно, способствует ли лечение антибиотиками в условиях больницы увеличению передачи лекарственно-устойчивого Kpn .

    Наше понимание болезненного состояния, связанного с Klebsiella pneumoniae , получено в основном на животных моделях, изучающих инфекции легких и мочевыводящих путей.В то время как эти исследования выявили бактериальные факторы и факторы хозяина, которые вносят вклад в вирулентность Kpn , существует очень мало понимания механизмов колонизации желудочно-кишечного тракта и передачи от хозяина к хозяину. Считается, что тесный контакт, особенно в условиях больницы, способствует распространению Kpn от инфицированного хозяина к наивному хозяину. Считается, что передача происходит фекально-оральным путем, либо в результате плохой гигиены, либо при контакте с загрязненными поверхностями (фомитами) (20, 22-24).

    Здесь мы описываем новую мышиную модель, позволяющую изучить колонизацию, шеддинг и передачу от хозяина к хозяину Kpn GI. Используя пероральный путь инокуляции Kpn в популяции инбредных мышей, мы исследовали колонизацию и передачу K. pneumoniae в желудок. Мы демонстрируем, что Kpn может стабильно колонизировать желудочно-кишечный тракт без лечения антибиотиками, и эти мыши остаются постоянно колонизированными и могут передавать Kpn своим товарищам по клетке.Кроме того, лечение мышей-носителей антибиотиками вызывает дисбактериоз кишечника и запускает временный фенотип супершеддера.

    Материалы и методы

    Заявление об этике

    Это исследование было проведено в соответствии с руководящими принципами, изложенными в требованиях к благополучию животных Национального научного фонда и Политике службы общественного здравоохранения в отношении гуманного ухода и использования лабораторных животных (27). Баптистский медицинский центр Wake Forest IACUC следит за благополучием, благополучием, надлежащим уходом и использованием всех позвоночных животных. Номер утвержденного протокола для этого проекта — A18-160.

    Условия роста бактерий и конструкция штамма

    Штаммы, использованные в исследовании, перечислены в таблице 1. Изоляты K. pneumoniae выращивали в бульоне Luria-Bertani (LB) Lennox при постоянном перемешивании при 37 ° C. Для всех инфекций мышей ночную культуру Kpn центрифугировали при ∼27000 x г в течение 15 минут, и полученный осадок ресуспендировали в аналогичном объеме 1X фосфатно-солевого буфера (PBS).Для получения желаемой плотности для инфекций мышей (10 6 КОЕ / 100 мкл) бактериальную суспензию в PBS разбавляли 2% раствором сахарозы-PBS. Десятикратные серийные разведения высевали на селективную среду (LB-Agar с антибиотиком) и инкубировали при 30 ° C в течение ночи для количественного культивирования. LB-планшеты, содержащие антибиотики: стрептомицин (str, 500 мкг / мл), хлорамфеникол (50 мкг / мл), ампициллин (25 мкг / мл), апрамицин (50 мкг / мл), спектиномицин (30 мкг / мл) и рифампицин (30 мкг). / мл).

    Ген wzi кодирует консервативный белок внешней мембраны, участвующий в прикреплении капсульного полисахарида к внешней мембране.Полиморфизм последовательности в гене wzi был использован для идентификации и характеристики различных изолятов. Kpn AZ10 ( wzi 372), чувствительный к антибиотику изолят был сделан устойчивым к str, как описано, впоследствии был пассирован GI мыши и назван AZ99 (28, 29). Для конструирования мутанта fimH на соответствующем генетическом фоне проводили ПЦР с использованием полимеразы Q5 (NEB) с геномной ДНК AZ101 в качестве матрицы и праймеров fimH перед (GGCGGTGATTAACGTCACCT) и fimHTGTGATTAACGTCACCT), которые дают гомология по крайней мере 500 пар оснований на любом конце кассеты транспозона.Продукт ПЦР очищали с использованием набора Qiagen MinElute. Мутагенез с лямбда-красным проводили, как описано ранее (30), и клетки выделяли в среде Super Optimal Broth с репрессией катаболита (SOC) при 30 ° C и встряхивании в течение ночи. Выделенные бактерии высевали на селективный агар LB, содержащий хлорамфеникол (50 мкг / мл). Отдельные колонии очищали, и мутацию подтверждали с помощью ПЦР.

    Для определения ориентации промотора fim была проведена ПЦР с использованием либо образцов in vitro, из бульона LB, отдельных колоний из чашек LB, либо образцов in vivo (фекальные гранулы) от мышей, инфицированных Kpn .Бульонную культуру центрифугировали, как описано выше, ресуспендировали в равном объеме dH 2 O и кипятили в течение 5 минут. Кроме того, единственную колонию ресуспендировали в 10 мкл dH 2 O и кипятили в течение 5 минут. ДНК выделяли из фекальных гранул (100 мг) с использованием Quick-DNA ™ Fecal / Soil Microbe Microprep (Zymo Research). 5 мкл образца использовали в ПЦР с полимеразой OneTaq (NEB) с праймерами Cas168 GGGACAGATACGCGTTTGAT и Cas169 GCCTAACTGAACGGTTTGA, как описано ранее (31). Очищенный продукт ПЦР расщепляли рестрикционным ферментом HinFI (NEB) в течение 1 часа и разделяли на 1.2% агарозный гель. Как было установлено ранее, «выключенная ориентация» промотора fim приводит к полосам продукта размером 496 п.о. и 321 п.н., тогда как «включенная ориентация» приводит к полосам 605 п.о. и 212 п.н. (31).

    Инфекции мышей для колонизации и выделения

    Колонии мышей C57BL / 6J (SPF), полученные из лаборатории Джексона (Бар-Харбор, штат Мэн), разводили и содержали в стандартном помещении для животных в Biotech Place, Wake Forest Baptist Medical Center. Все работы с животными выполнялись в соответствии с руководящими принципами Американской ассоциации лабораторных исследований животных (AALAS) {Worlein, 2011 # 87} и с одобрения Институционального комитета по уходу и использованию животных (IACUC) Медицинского центра баптистов Уэйк Форест.Мышей в возрасте 5-7 недель инфицировали и наблюдали за ними в ходе экспериментов. Пища была удалена от мышей за 6 часов до инокуляции. Мышей кормили примерно 10 6 КОЕ / 100 мкл K. pneumonia в двух дозах по 50 мкл 2% сахарозы-PBS с интервалом в час из наконечника пипетки. Сразу после этого мышам возвращали пищу.

    Для количественной оценки ежедневного выделения бактерий мышей вынимали из их жилищ и помещали в контейнеры для изоляции. Фекальные гранулы (~ 0,02 г, примерно 2 гранулы) собирали и помещали в пробирку с завинчивающейся крышкой на 2 мл (Fisherbrand, 02-682-558) вместе с по меньшей мере 2 стеклянными шариками (BioSpec, 11079127).Образцы разбавляли 1:10 в PBS (вес: объем). Бисерную мельницу 24 (Fisherbrand) использовали для гомогенизации фекальных гранул (2,1 установка мощности, 1 мин). После этого пробирки вращали в мини-центрифуге (Thermo Scientific, MySpin 6) для осаждения более крупных частиц. Десятикратные серийные разведения высевали из супернатанта на соответствующие планшеты с антибиотиками и инкубировали в течение ночи при 30 ° C. Выделение бактерий рассчитывали в КОЕ на грамм фекалий. Предел обнаружения составил 100 КОЕ / г. Каждая мышь была уникально помечена, чтобы можно было отслеживать выделение фекалий каждой отдельной мыши на протяжении всего эксперимента.

    Для запуска антибиотико-зависимого фенотипа супершеддер Kpn мышей инфицировали перорально str-резистентным Kpn , как описано выше. Через четыре-пять дней после инокуляции (p.i) мышам вводили зонд стрептомицином (5 мг / 200 мкл) либо один раз, либо в течение трех последовательных дней, и ежедневное выделение контролировали после лечения антибиотиками. Чтобы определить эффект лечения неомицином до инфицирования Kpn , мышам вводили однократную дозу (5 мг / 200 мкл) через желудочный зонд за 24 часа до инокуляции MKP103, производного изолята KPNIh2 с делецией гена, кодирующего карбапенемазу KPC-3. (32).Подсчет бактерий подсчитывали по фекальным осадкам, как описано выше. Чтобы определить роль непрерывного лечения антибиотиками в фенотипе супершеддера, питьевую воду заменяли водой, содержащей 1 г / л ампициллина, за 24 часа до заражения; мышей содержали на ампициллин-воде в течение 10 дней p.i. после чего их помещали в обычную воду до конца эксперимента. Фекальное выделение Kpn оценивали до 20 дней после инфицирования и количественно оценивали, как описано выше.

    Для конкурентных экспериментов мышей инфицировали смесью 1: 1 AZ94 и интересующего мутанта.Фекальное выделение обоих штаммов оценивали, как описано выше. Гомогенаты фекалий высевали на агар LB с апрамицином (50 мкг / мл) и str (500 мкг / мл). Индекс конкурентоспособности (CI) рассчитывался, как описано ранее (33), с использованием следующего уравнения:

    Значение 0 предполагает, что ни один из штаммов не имеет преимущества. Значение> 1 указывает на то, что мутант имеет конкурентное преимущество, тогда как значение <1 указывает на преимущество WT.

    Для определения плотности колонизации в желудочно-кишечном тракте подвздошная кишка, слепая кишка и толстая кишка были удалены в стерильных условиях сразу после CO 2 (2 л / мин, 5 мин) эвтаназии животных и последующей сердечной пункции.Слепая кишка, проксимальный отдел толстой кишки и участок конечного отдела подвздошной кишки, равный длине ободочной кишки, удаляли у каждого животного. Органы взвешивали и помещали в отдельные пробирки с завинчивающейся крышкой на 2 мл (Fisherbrand, 02-682-558), по меньшей мере, с 2 стеклянными шариками (BioSpec Products, 11079127). Образцы разбавляли 1:10 в PBS (масса: объем), гомогенизировали и высевали, как описано выше. Предел обнаружения составил 100 КОЕ / г.

    Для определения плотности колонизации в почках, печени и селезенке органы удаляли в стерильных условиях сразу после эвтаназии, как описано выше.Органы взвешивали и помещали в конические пробирки объемом 15 мл. Для почек и печени добавляли вес PBS, равный объему, и образцы гомогенизировали с помощью PowerGen 700 (настройка мощности 2 в течение 30 секунд), тогда как для селезенки к массе органа добавляли объем 1X PBS, в десять раз превышающий объем, и гомогенизировали как над. Образцы наносили на чашки, как описано. Предел обнаружения почек и печени составил 33 КОЕ / мл, а для селезенки — 100 КОЕ / мл.

    Промывание ротоглотки проводили 200 мкл стерильного PBS из желудочной иглы, введенной в пищевод.Пищевод был обнажен и разрезан в поперечном направлении. Затем в разрез пищевода вводили иглу для желудочного зонда, присоединенную к предварительно заполненному инсулиновому шприцу (BD) 1X PBS, и собирали PBS изо рта. Собранный лаваж был серийно разбавлен и помещен на соответствующие планшеты с антибиотиками и инкубирован в течение ночи при 30 ° C. Предел обнаружения при промывании полости рта составил 33 КОЕ / мл.

    Исследования передачи

    Для экспериментов по передаче 4: 1 и 1: 4 мышей с индексом C57BL / 6J (n = 1 или n = 4) в возрасте 5-7 недель инфицированы Kpn , как описано выше, и происходит линька. собирают ежедневно для определения плотности колонизации желудочно-кишечного тракта.На 4 день p.i. контактных мышей (n = 4 или n = 1) помещали в клетки с индексными мышами. Фекальное выделение индексных и контактных мышей собирали и количественно оценивали в течение по меньшей мере 6 дней после сожительства, всего 10 дней для индексных мышей и 6 дней для контактных мышей. На 10 день мышей умерщвляли, как описано выше, и промывания подвздошной кишки, слепой кишки, толстой кишки и полости рта всех мышей обрабатывали, как описано выше, для определения плотности колонизации Kpn .

    В экспериментах по передаче 1: 4, в которых оценивалось введение однократной дозы антибиотика, индексные мыши были инфицированы str-устойчивым Kpn , и выделение Kpn в фекалиях было определено количественно в течение 4 дней p.я. На 5 день p.i индексных мышей обрабатывали стрептомицином (5 мг / 200 мкл) через желудочный зонд и затем помещали вместе с контактными мышами. Фекальные выделения собирали ежедневно у мышей индекса и контактных мышей. В непрерывном исследовании передачи антибиотиков индексную мышь помещали в воду, содержащую ампициллин (1 г / л), за 24 часа до заражения. Контактных мышей помещали в воду, содержащую ампициллин (1 г / л), за 24 часа до введения указательной мыши. После совместного размещения у мышей-индексов и контактных мышей собирали данные о ежедневном выделении, чтобы определить, произошли ли какие-либо события передачи.

    Чтобы подтвердить, что события передачи от хозяина к хозяину происходят фекально-оральным путем, была использована метаболическая клетка (Tecniplast Cat. # 3700M022). Заражение Kpn проводили, как описано выше. Через 4 дня после инфицирования контактную мышь помещали в метаболическую клетку и собирали фекальные выделения как у индексных, так и у контактных мышей, чтобы определить частоту передачи.

    Гистология

    Мышей инфицировали либо PBS (контроль, содержащий только носитель), либо изолятом KPPR1S.Подмножеству мышей, инфицированных Kpn , вводили зонд стрептомицином (однократная обработка; 5 мг / 200 мкл), чтобы вызвать состояние суперседдера через 5 дней p.i. В качестве положительного контроля мышей помещали в питьевую воду ad libitum в течение 7 дней с 3% -ным (масс. / Об.) Декстран-сульфатом натрия (DSS) с молекулярной массой 50 000 в питьевой воде. Все мыши были умерщвлены на 7-й день после первоначального лечения или заражения. Собирали 2,5 см толстой кишки, непосредственно дистальнее слепой кишки, промывали 1x PBS и получали методом швейцарских рулонов.После этого образец консервировали в формалине 1:10 (Fisherbrand, 305-510) и через 24 часа переносили в 70% этанол. Образцы залили парафином перед тем, как сделать срезы, закрепить и окрасить гематоксилином и эозином (H & E). Полученные слайды были оценены отделением патологии Баптистского медицинского центра Уэйк Форест.

    Печень собирали в стерильных условиях либо у ложно инфицированных мышей, либо у мышей, инфицированных орально hvKP1, и в крайнем случае. Образцы печени были разрезаны примерно на 6 частей.5 мм и помещают в 10% формалин (10 частей формалина на 1 часть ткани). Через 24-48 часов образцы переносили в 70% этанол и хранили при 4 ° C до дальнейшей обработки для окрашивания H & E и по Граму с подсчетом баллов, как описано выше.

    Анализ фекального микробиома

    Фекальный микробиом исследовали согласно ранее описанным методам (34-36). Вкратце, геномную ДНК из 200 мг фекалий экстрагировали с использованием набора MoBio Powerfecal DNA (Qiagen, Валенсия, Калифорния) в соответствии с инструкциями производителя.Ампликонная ПЦР гипервариабельной области V4 гена 16S рДНК была выполнена с использованием универсальных праймеров 515F (штрих-код) и 806R в соответствии с протоколом Earth Microbiome Project (PMID: 22402401). Ампликоны очищали с использованием магнитных шариков AMPure ® (Agencourt), а продукты количественно определяли с помощью флуориметра Qubit-3 (InVitrogen). Конечная библиотека ампликонов была создана, как описано ранее (37). Эквимолярную объединенную библиотеку секвенировали на платформе Illumina MiSeq с использованием набора реагентов 2 × 300 п.н. (набор реагентов Miseq v3; Illumina Inc.) для парного секвенирования. Контроль качества секвенирования осуществлялся с помощью встроенного программного обеспечения Miseq Control и Miseq Reporter (Illumina Inc.), а полученные последовательности были демультиплексированы, отфильтрованы по качеству, кластеризованы и проанализированы с использованием программного пакета QIIME (34, 35, 38, 39). . Таксономическая классификация проводилась в QIIME на основе 97% сходства последовательностей с базой данных Greengenes (38). Альфа-разнообразие и пропорции бактерий сравнивали с помощью теста Краскела-Уоллиса с последующим попарным тестом Манна-Уитни.Линейный дискриминационный анализ (LDA) размер эффекта (LEfSe) был применен для выявления отличительных признаков (уникальных бактериальных таксонов), которые определяют различия в разные моменты времени или в разных группах (40). Иерархическая кластеризация и тепловые карты, отображающие закономерности численности, были построены в статистическом программном пакете «R» (версия 3.6.0; https://www.r-project.org/) с использованием «тепловой карты.2» и «ggplots» пакеты.

    Статистический анализ

    Все статистические анализы были выполнены с использованием GraphPad Prism 8.0 (GraphPad Software, Inc., Сан-Диего, Калифорния). Если не указано иное, различия определяли с использованием теста Манна-Уитни U (сравнение двух групп) или теста Краскела-Уоллиса с последующим анализом Данна (сравнение нескольких групп).

    Результаты

    Установление колонизации

    Klebsiella pneumoniae в кишечном тракте мышей

    Мы стремились создать GI-модель колонизации Klebsiella pneumoniae , которая имитировала бы естественную колонизацию в хозяине.Из-за сложности установления колонизации GI Kpn через желудочный зонд, в предыдущих исследованиях использовалась предварительная обработка антибиотиками, чтобы разрушить микробиоту хозяина и позволить колонизацию Kpn через желудочный зонд (41-43). Сначала мы протестировали способность Kpn колонизировать желудочно-кишечный тракт, дав взрослым мышам дозы в диапазоне от 10 5 -10 9 КОЕ / 100 мкл без лечения антибиотиками, чтобы не нарушить микробиоту хозяина ( Рис. 1A ).Однако вместо лечения через желудочный зонд мышей инфицировали перорально из пипетки, чтобы имитировать естественный путь заражения (44). Мы использовали клинический изолят Kpn KPPR1S, который широко использовался для моделирования у мышей болезненного состояния, связанного с Kpn . Устойчивость к стрептомицину и рифампину KPPR1S позволила нам подсчитать бактерии в фекальных гранулах на селективных чашках. Как видно из , фиг. 1B-C , Kpn колонизировал желудочно-кишечный тракт и сильно выделялся с фекалиями мышей с дозами выше 10 5 КОЕ.Доза <10 5 КОЕ не приводила к установлению колонизации (порог обнаружения 100 КОЕ), что позволяет предположить, что требуется минимальная доза 10 5 (данные не показаны). Основываясь на этих результатах, мы выбрали 10 6 КОЕ в качестве минимальной дозы, необходимой для установления колонизации Kpn . Основываясь на наших предварительных исследованиях, которые показывают, что плохое выделение фекалий Kpn коррелирует со снижением колонизации ЖКТ, мы использовали ежедневное выделение фекалий в качестве замены плотности колонизации в ЖКТ.Затем мы определили, как долго Kpn колонизирует желудочно-кишечный тракт мыши. Мы проследили выделение Kpn с фекалиями инфицированных мышей в течение 15 или 30 дней p.i и наблюдали, что Kpn выделялось на аналогичных уровнях на протяжении всего исследования (рис. 1D-E) . Кроме того, наши результаты показали, что Kpn колонизирует слизистую оболочку ротоглотки ( Fig. 1F ). Взятые вместе, наши данные позволяют предположить, что при пероральном введении Kpn колонизирует слизистую оболочку ротоглотки, может закрепляться и сохраняться в желудочно-кишечном тракте и активно выделяется с фекалиями.

    Рисунок 1.

    K. pneumoniae колонизирует желудочно-кишечный тракт мышей. (A) Схематическое изображение мышей C57BL / 6J, орально инфицированных изолятом K. pneumoniae KPPR1S (10 5 , 10 6 , 10 8 и 10 9 КОЕ). (B-C) показывает количественные результаты ежедневного выделения и плотность колонизации в кишечном тракте (подвздошная кишка, слепая кишка и толстая кишка) на 7 день после инокуляции от мышей, получавших различные дозы Kpn . (D-E) Данные о выделении фекалий, собранные у мышей, которым вводили 10 6 КОЕ KPPR1S, и наблюдались в течение 15 или 30 дней после заражения. (F) (i, ii) Плотность колонизации изолята KPPR1S в ротоглотке и нижнем отделе желудочно-кишечного тракта мышей через 15 дней после инокуляции. Полоски указывают средние значения. L.O.D, предел обнаружения.

    Отличительной чертой изолятов K. pneumoniae является их генетическая гетерогенность, которая влияет на их способность вызывать заболевания (45).Таким образом, мы определили, вносит ли генетическая пластичность Kpn также вклад в колонизацию ЖКТ. Мы проверили способность набора генетически разнообразных клинических изолятов Kpn колонизировать желудочно-кишечный тракт мышей. Для анализа мы выбрали MKP103, производное KPNIh2, которое стало причиной вспышки в Клиническом центре NIH, hvKP1, гипервирулентный изолят человека, и AZ99, фекальный изолят человека. Все три штамма показали разную плотность колонизации желудочно-кишечного тракта мыши, при этом уровень выделения hvKP1 был аналогичен KPPR1S ( рис.2А ). Удивительно, но изолят MKP103 колонизировал плохо, и мыши обычно выводили его из своего желудочно-кишечного тракта к 5 дню p.i. Как видно по выделению фекалий, изолят фекалий человека AZ99 постоянно колонизировал желудочно-кишечный тракт, хотя и с меньшей плотностью по сравнению с KPPR1S. Более того, мыши, колонизированные hvKP1, имели высокий уровень смертности ( фиг. 2C ). Известно, что гипервирулентные изоляты вызывают гнойные абсцессы печени (PLA) (11). Как показано на рис. 2D , мыши , погибшие после пероральной инокуляции изолята hvKP1, были колонизированы с высокой плотностью в печени, почках и селезенке тем же изолятом.Более того, у этих мышей, по-видимому, развились абсцессы печени (фиг. 3A) , которые, как подтвердило окрашивание H&E и по Граму, содержат некротическую ткань, воспалительные клетки и грамотрицательные бактерии (фиг. 3B-D) . Таким образом, наша модель имитирует динамику заболевания человека, где гипервирулентный изолят (hvKP1) способен перемещаться из желудочно-кишечного тракта в другие стерильные участки и вызывать развитие болезненного состояния.

    Рисунок 2.

    Различия между клиническими изолятами K. pneumoniae по уровням выделения фекалий и вирулентности. (A.) Мышей инфицировали указанным изолятом K. pneumoniae с показанными ежедневными значениями выделения. (B.) Сравнение между мышами, инфицированными штаммом MKP103 K. pneumoniae , с предварительной обработкой антибиотиком неомицином (5 мг / 200 мкл) или без нее. Символы представляют значения потери, полученные от одной мыши в заданный день. Полоса представляет собой среднее значение. Пунктирная линия представляет предел обнаружения (L.O.D). (C.) Выживаемость мышей, инфицированных в желудочно-кишечном тракте K.pneumoniae изолят KPPR1S (n = 10) или hvKP1 (n = 10) в течение 15 дней. Состояние экстремизма или смерть оценивались как невыживание. Логранговый тест (Мантел-Кокса), выполняемый для определения статистических различий. **, P < 0,01 для KPPR1S по сравнению с hvKP1. (D.) Гистограмма, показывающая среднюю плотность колонизации гипервирулентного изолята hvKP1 в почках, печени и селезенке от мышей, которые были первоначально инфицированы перорально столбцами S.E.M. Каждая точка данных представляет собой плотность колонизации в определенном органе конкретной мыши.Органы были получены от мышей, находившихся в экстремальном состоянии. Предел обнаружения печени и почек составил 33 КОЕ / мл и 100 КОЕ / мл для селезенки.

    Рисунок 3.

    Представитель K. pneumoniae абсцессы печени (красные стрелки) от мышей, которые умерли от инфекции изолятом hvKP1, который первоначально колонизировал их желудочно-кишечный тракт (A.) . Образцы ткани печени, окрашенные гематоксилином и окрашенные эозином. Здесь показан образец ткани печени с разрешением 20X от неинфицированных мышей (B.) , показывающий нормальные гептаоциты или инфицированных мышей (C.) , который содержит большую область коагуляционного и литического некроза с гепатоцеллюлярной диссоциацией, включая центральные инфильтраты нейтрофилов (*) с несколькими разбросанными мононуклеарными воспалительными клетками. Периферический аспект поражения содержит многочисленные лимфоциты, макрофаги и новые рассеянные нейтрофилы (стрелки). (D) 100-кратное изображение масляной иммерсии обведенной рамкой области от C, показывающее грамотрицательные бактерии, присутствующие в некротизированной ткани печени.

    Лечение антибиотиками приводит к развитию фенотипа супершеддера

    Kpn

    Учитывая, что фекально-оральный путь передачи в больничных условиях считается значительной причиной внутрибольничных инфекций (46, 47), было неожиданно, что изолят MKP103 не удалось колонизировать желудочно-кишечный тракт мышей ( фиг. 2А, ). Однако, поскольку многие пациенты, которые приобрели MKP103 в желудочно-кишечном тракте, получали антибиотики (20), мы рассмотрели вопрос о том, повлияет ли использование антибиотиков на способность этого изолята колонизировать желудочно-кишечный тракт.Более того, широкое использование антибиотиков в медицинских учреждениях коррелирует с инфекциями, вызванными Klebsiella pneumoniae, (20). Поэтому мышам вводили через зонд неомицин для снижения устойчивости к колонизации микробиотой желудочно-кишечного тракта хозяина, а затем инфицировали MKP103, чтобы определить, влияет ли лечение антибиотиками положительно на их способность колонизировать. Как показано на фиг. 2B , предварительная обработка мышей антибиотиком позволила MKP103 колонизироваться и сохраняться в инфицированном желудочно-кишечном тракте хозяина до 15 дней после инфицирования.

    Наши результаты показывают, что лечение антибиотиками позволяет изоляту Kpn (MKP103), который плохо колонизируется, закрепиться в желудочно-кишечном тракте. Однако остается неизвестным, влияет ли лечение антибиотиками на плотность колонизации изолятов, которые активно колонизируют, не требуя лечения антибиотиками. Мы определили, приведет ли лечение антибиотиками к развитию фенотипа супершеддера, при котором инфицированный хозяин выделяет патоген в гораздо большем количестве, чем другой инфицированный хозяин.Это явление наблюдалось в естественных условиях и считается основным источником передачи вируса от хозяина к хозяину (48). Для характеристики этого фенотипа использовались мышиные модели, где> 10 8 КОЕ / г (пороговое значение супершеддер [SS]) указанного патогена в фекалиях обычно считается пороговым значением для фенотипа супершеддера (фенотип SS) (25, 26). Используя изолят KPPR1S, поскольку он постоянно колонизировал мышей с высокой плотностью без лечения антибиотиками, мы оценили фекальное выделение Kpn в течение 10-12 дней.я. либо после однократного лечения стрептомицином, либо после трех дней лечения стрептомицином. Мы обнаружили, что лечение антибиотиками запускало временный фенотип супершеддера (, фиг. 4A-B, ), тогда как такой фенотип не наблюдался с контролем, содержащим только носитель (PBS) (, фиг. S1A ). Вторая обработка антибиотиками после того, как мыши вернулись к исходным уровням Kpn , выделившимся после первой обработки антибиотиками, вызвала развитие другого временного фенотипа супершеддер (рис.S1B) .

    Рисунок 4.

    Лечение антибиотиками инфицированных K. pneumoniae мышей запускает фенотип супершеддер. Выделение фекалий от отдельных мышей (n = 9), инфицированных K. pneumoniae KPPR1S при однократной дозе стрептомицинсульфата (5 мг / 200 мкл) (A.) или (n = 4) при трех курсах лечения стрептомицином на последовательные дни (B.) , привели к быстрому развитию сильного выделения (> 10 8 КОЕ / грамм кала [порог супершеддера (SS)], продолжающегося в течение 3 дней после лечения антибиотиками. (C.) Высокое фекальное выделение изолята MKP103 K. pneumoniae от мышей (n = 6), получавших ампициллин (1 г / л) в питьевой воде. Снятие давления антибиотиков в конечном итоге приводит к уменьшению выделения фекалий (<10 8 КОЕ / грамм кала).

    В клинических условиях пациенты с ослабленным иммунитетом, как правило, постоянно получают лечение антибиотиками; Таким образом, мы определили эффект ежедневного лечения антибиотиками на выделение Kpn . Мы добавили в питьевую воду мышей ампициллин за 24 часа до инокуляции Kpn и продолжали в течение 10 дней p.я. Поскольку Kpn по своей природе устойчив к ампициллину, мыши, инфицированные изолятом MKP103, демонстрировали Kpn фенотип супершеддер (фиг. 4C) . После снятия давления антибиотика у мышей в течение нескольких дней проявлялся фенотип с высоким уровнем выделения. Взятые вместе, наши данные предполагают, что в результате лечения антибиотиками у Kpn может развиться фенотип супершеддера, и продолжительность этого фенотипа зависит от продолжительности лечения антибиотиками.

    Лечение антибиотиками приводит к нарушению микробиоты хозяина, что коррелирует с фенотипом супершеддер. Чтобы получить представление о состоянии носителя

    Kpn и фенотипе супершеддера, мы провели анализ 16S для определения изменений кишечной микробиоты хозяина, которые произошли во время инфекции и как следствие лечения антибиотиками ( рис.5А ). Для подробного анализа 16S мы выделили ДНК из образцов фекалий, собранных в шесть различных временных точек у инфицированных мышей Kpn (n = 4). Фекальные гранулы собирали перед инокуляцией для определения исходного уровня микробиоты желудочно-кишечного тракта хозяина. Образцы собирали на 7, 9 и 11 дни после лечения антибиотиками для определения изменений в микробиоте хозяина. На 3-й и 5-й дни p.i мы не смогли обнаружить последовательности гена Kpn 16S рРНК , даже несмотря на то, что она теряла 10 6 КОЕ / грамм фекального образца.Этот результат предполагает, что Kpn содержит только второстепенный компонент кишечной микробиоты хозяина. Основным компонентом разнообразного микробного сообщества кишечника хозяина являются Bacteroidetes ( Bacteroidales [ S24 -7]) и Firmicutes (Clostridales) (рис. 5C; Таблица S1) , которые считаются быть типичным профилем стабильной микробиоты кишечника млекопитающих.

    Рисунок 5.

    Фенотип суперэдера, вызванный антибиотиками, коррелирует с уменьшением разнообразия кишечных микробов. (A.) Среднее фекальное выделение изолята K. pneumoniae KPPR1S мышами-носителями (n = 4) до лечения антибиотиками и после лечения однократной дозой стрептомицина (5 мг / 200 мкл), что вызывает преходящий фенотип супершеддер. Планки погрешностей представляют S.E.M. Пунктирная линия представляет порог супершеддера (SS). (B.) Изменения кишечной микробиоты мышей-носителей из образцов, полученных в день 0 до заражения, на 3 и 5 день после инокуляции и на 7, 9 и 11 дни после лечения антибиотиками.ДНК выделяли из образцов фекалий, полученных от инфицированных мышей, и проводили анализ 16s рРНК. Данные представлены как индекс разнообразия Шеннона со средним значением и показанными значениями Stdev . Статистические различия рассчитаны по критерию Краскела-Уоллиса. (C.) Изменение микробного разнообразия, определенное по образцам фекалий в указанные выше дни и показанное в виде гистограммы с относительной численностью в процентах основных родов. Стрелка показывает идентификацию ДНК Klebsiella pneumoniae на 7-й день после инфицирования.*, p значение <0,05, **, p < 0 . 01

    Однократная обработка str привела к резким изменениям микробиоты кишечника. Как подробно описано в Рис. 5B , произошло статистически значимое снижение общего видового богатства, особенно для S24-7 , с одновременным увеличением для Erwinia и Bacteroides . Как проиллюстрировано на фиг. , фиг. 5C , мы наблюдали только последовательности гена 16s рРНК, специфичных для Kpn , во время индуцированного антибиотиком фенотипа супершеддера.Снижение уровней выделения Kpn коррелировало с увеличением S24-7 и других основных компонентов микробиоты хозяина, а также с потерей обнаружения Kpn специфичных последовательностей 16s рРНК. Таким образом, лечение антибиотиками приводит к нарушению микробиоты хозяина, что коррелирует с развитием временного фенотипа супершеддера. Более того, нарушение микробиоты хозяина антибиотиками связано со снижением микробного богатства, которое восстанавливается через три дня после воздействия антибиотиков.

    Факторы Klebsiella pneumoniae , способствующие выделению и колонизации

    Чтобы изучить вклад известных детерминант вирулентности Kpn , мы протестировали выделение и колонизацию ранее описанного мутанта с дефицитом капсул (cps) (Δ manC ) штамм КППР1С. Как видно из фиг. 6A , в течение 15 дней инфицирования мутант ΔmanC терял, а также плохо колонизировал (фиг. S2) по сравнению с родительским штаммом дикого типа (WT).

    Рисунок 6.

    Влияние факторов вирулентности K. pneumoniae на выделение фекалий и колонизацию ротоглотки. (A.) Мышей инфицировали орально KPPR1S (WT) или мутантом с дефицитом капсулы ( ΔmanC ) и собирали фекальные выделения в указанные дни. Каждый символ представляет КОЕ, полученный от одной мыши в данный день, а сплошная линия представляет средние значения. (B.) Мышей инфицировали перорально смесью WT 1: 1 или мутантом с дефицитом капсулы ( ΔmanC ) с выделением фекалий в указанные дни.CI определяли, как описано в материалах и методах. Каждый символ представляет значение Log 10 CI для отдельной мыши в заданный день. Сплошная линия представляет собой медианное значение. Пунктирная линия указывает конкурентный индекс, равный 1, или отношение мутанта к WT 1: 1. (C.) Мышей инфицировали орально WT или изогенным мутантом ( fimH :: cam; FimH-), и фекалии собирали в указанные дни. (D.) Мышей инфицировали перорально смесью WT 1: 1 или мутантом (FimH-) с выделением фекалий, собранных в указанные дни.CI определяли, как указано в разделе «Материалы и методы». (E.) Плотность колонизации в ротоглотке для изолята WT и изогенных мутантов определяли через 15 дней после инфицирования с показанными средними значениями. Для статистических различий CI определяется знаковый ранговый критерий Уилкоксона. Тест Манна-Уитни используется для определения различий в выделении фекалий. Различия в колонизации ротоглотки определяли с помощью теста Краскела-Уоллиса. *, р < 0 . 05 , **, p < 0 . 01 , ***, p < 0 . 001 .

    Бактерии могут образовывать биопленочные структуры в желудочно-кишечном тракте (49). Мы предположили, что коинфекция WT Kpn и штаммом Δ manC будет формировать смешанную популяционную (внутривидовую) биопленку в желудочно-кишечном тракте, помогая компенсировать дефицит капсулы штамма Δ manC . Тем не менее, коинфицированные мыши по-прежнему слабо выделяли штамм Δ manC по сравнению с родительским штаммом ( рис.6Б ). Эти наблюдения предполагают, что капсульный полисахарид Kpn необходим для устойчивой колонизации ЖКТ и возможного выделения фекалий.

    Далее, поскольку фимбрии типа 1 Kpn считаются необходимыми для колонизации мочевыводящих путей хозяина, мы определили ее роль в колонизации ЖКТ (31). Промотор локуса KPPR1S fim находится под контролем фазовых переменных, который, как наблюдали, находился в выключенном положении как под in vitro, (бульонная культура), так и под in vivo (фекальные осадки) (данные не показаны).Чтобы определить потребность фимбрий типа 1 для KPPR1S в колонизации ЖКТ, был сконструирован делеционный мутант fimH , который кодирует кончик адгезина фимбрий 1 типа, необходимый для правильного взаимодействия с эпителиальным слоем хозяина (50). Как видно из фиг. 6C-D , даже несмотря на то, что у мышей, инфицированных мутантом fimH , медиана выделения была снижена, она не была значительно ниже, чем у штамма WT. Наконец, мы определили, вносят ли эти мутанты также вклад в колонизацию поверхности слизистой оболочки ротоглотки. На фиг. 6E показано, что капсула необходима для колонизации ротоглоточного пространства, тогда как фимбрии типа 1 не требуются. В целом наши данные показывают, что капсульный полисахарид Kpn играет критическую роль в колонизации ЖКТ. Напротив, фимбрии Kpn type1, по-видимому, несущественны для колонизации кишечника.

    Передача Klebsiella pneumoniae происходит фекально-оральным путем

    Передача кишечных патогенов обычно происходит фекально-оральным путем, и передача от хозяина к хозяину в условиях больницы является основным источником инфекции (20, 46 ).Таким образом, мы определили, могут ли события передачи Kpn от хозяина к хозяину наблюдаться в нашей модели на животных. Первоначально мы разместили одну неинфицированную мышь (контакт) с четырьмя инфицированными мышами (индекс). Фекальные гранулы собирали для подсчета плотности колонизации и того, произошла ли передача от основной к контактировавшей мыши. Мы наблюдали 100% эффективность передачи при соотношении 4: 1, при этом передача происходила в течение 24 часов после совместного проживания животных ( рис. 7A и C ). Поскольку эффективность передачи высока при соотношении 4: 1, мы решили определить динамику передачи Kpn с одной индексной мышью, размещенной вместе с четырьмя контактными мышами.При соотношении 1: 4 наблюдалась пониженная эффективность передачи (~ 35%), предполагая, что произошло недостаточно событий выделения Kpn , чтобы все неинфицированные мыши стали колонизированными ( фиг. 7B-C ).

    Рисунок 7.

    K. pneumoniae Передача между хозяевами с лечением антибиотиками и без него. (A.) Представляет соотношение индекса и контакта передачи 4: 1. Четыре наивные мыши были инфицированы перорально KPPR1S и помещены с одной не инфицированной мышью.Фекальное выделение контролировали ежедневно как индексной, так и контактной мышью. (B.) Представляет соотношение индексной и контактной передачи 1: 4. Одна наивная мышь была инфицирована перорально KPPR1S и содержалась с четырьмя неинфицированными мышами и ежедневно контролировалась выделение фекалий (C.) Наблюдаемая эффективность передачи K. pneumoniae с различным соотношением инфицированных и неинфицированных, эффектом антибиотиков и динамикой передачи в организме. метаболическая клетка. Статистические различия рассчитываются с использованием двустороннего точного критерия Фишера.

    Затем, чтобы имитировать условия, распространенные в больнице, где пациенты обычно принимают антибиотики, мы исследовали влияние лечения антибиотиками на динамику передачи Kpn . Однократное лечение антибиотиком индексной мыши, объединенной с четырьмя контактными мышами, привело к передаче> 90%, что позволяет предположить, что высокий уровень выделения Kpn в фекальных гранулах может преодолеть устойчивость к колонизации контактных мышей ( фиг. 7C ). Наконец, мы проверили действие антибиотиков как на индексных, так и на контактных мышах, добавив антибиотики в их питьевую воду.Индексную мышь инфицировали MKP103 и содержали отдельно в течение нескольких дней, а затем вводили четырем контактным мышам, уже принимавшим антибиотики. Мы наблюдали 100% эффективность передачи, когда и индексные, и контактные мыши получали антибиотики ежедневно. Более того, поскольку все мыши в клетке принимали антибиотики, у всех развился фенотип супершеддера ( Fig. S3A ). Наши результаты дают представление о высокой трансмиссивности Kpn в больницах, где широко используются антибиотики.

    Мы предполагаем, что передача Kpn происходит фекально-оральным путем, основываясь на моделях передачи других кишечных патогенов и копрофагальной природе мышей. Однако, поскольку Kpn колонизирует как ротовую полость, так и желудочно-кишечный тракт, мы определили, является ли передача Kpn от хозяина к хозяину результатом копрофагального действия мышей или контактом с инфицированными выделениями из ротовой полости. Мышей содержали в метаболической клетке, где у них нет доступа к фекальным гранулам.При соотношении индекса и контактных мышей 4: 1 не было обнаружено событий передачи между инфицированными и неинфицированными мышами в течение 10-дневного эксперимента, что позволяет предположить, что в нашей модели на животных передача от хозяина к хозяину требует контакта с фекалиями. материи ( Рис. 7C ). Наконец, инфицированные мыши в метаболической клетке теряли Kpn , что убедительно свидетельствует о постоянной колонизации, которая не требовала повторного посева через потребление инфицированных фекальных гранул (, фиг. S3B ).

    Обсуждение

    Генетическая гетерогенность Klebsiella pneumoniae позволяет этому патогену колонизировать различные поверхности слизистой оболочки хозяина, что может существенно повлиять на клинический результат. Klebsiella pneumoniae проявления заболевания дыхательных и мочевыводящих путей были тщательно смоделированы на животных (4). Однако поверхность слизистой оболочки желудочно-кишечного тракта, которая также легко колонизируется Kpn , не была предметом многих научных исследований (51, 52).В этом отчете мы описываем мышиную модель оральной инфекции K. pneumoniae для изучения колонизации ЖКТ и передачи от хозяина к хозяину. Мы впервые демонстрируем, что Kpn может стабильно колонизировать желудочно-кишечный тракт иммунокомпетентных мышей, не нарушая микробиоту хозяина — ключевую силу нашей модели. Во-вторых, хозяин, постоянно колонизируемый патогеном, считается значительным резервуаром для новых инфекций, и наша животная модель колонизации GI Kpn воспроизводит этот фенотип, указывая на то, что это полезный инструмент для изучения событий внутри хозяина и между хозяином коробка передач.В-третьих, мы наблюдали вариабельность способности колонизировать желудочно-кишечный тракт и вызывать инвазивные заболевания между разными изолятами Kpn , предполагая, что генетическая пластичность Kpn может быть вовлечена в наблюдаемую вариабельность. Наконец, поскольку многие пациенты в больницах, как правило, принимают антибиотики, мы впервые смогли экспериментально показать, что лечение антибиотиками запускает развитие фенотипа супершеддера у мышей-носителей, что способствует передаче от хозяина к хозяину.

    В предыдущих исследованиях использовалось лечение антибиотиками для снижения устойчивости к колонизации хозяина путем разрушения резидентной микробиоты для установления колонизации Kpn (31, 41, 53). Однако лечение антибиотиками снижает способность распознавать роль бактериальных факторов, которые позволяют Kpn преодолевать устойчивость к колонизации. Наша модель не требует использования антибиотиков для установления стабильной и стойкой колонизации Kpn и, следовательно, позволяет идентифицировать бактериальные факторы и факторы хозяина, которые способствуют колонизации и передаче Kpn .В наших первоначальных исследованиях мы установили, что путь заражения имеет решающее значение для стабильной колонизации Kpn в желудочно-кишечном тракте. Пероральный желудочный зонд, стандартный способ инфицирования для моделирования кишечных инфекций на мышиных моделях, приводил только к временной колонизации Kpn в желудочно-кишечном тракте (данные не показаны). Однако пероральное введение аналогичной дозы позволило Kpn колонизировать желудочно-кишечный тракт и сохраняться без нарушения микробиоты хозяина. Недавнее исследование Atarashi et al .показали, что Kpn , колонизирующий ротовую полость пациентов, может засеять желудочно-кишечный тракт (44). В нашей модели инфекции мы также наблюдали, что Kpn колонизирует ротовую полость мышей.

    Отличительной чертой многих патогенов ЖКТ является их способность вызывать острый воспалительный ответ хозяина. Многочисленные отчеты также предполагают, что Kpn может способствовать дисбактериозу кишечника и играть активную роль в индукции ответа хозяина (44, 54). Однако эпидемиологические данные также предполагают, что Kpn может незаметно колонизировать здоровых людей (18).В нашей мышиной модели мы не смогли обнаружить никаких острых признаков воспаления после инфекции Kpn . Более того, в отличие от фенотипа супершеддер Salmonella серовара Typhimurium , фенотип супершеддера, индуцированный антибиотиками Kpn , не был связан с колитом ( рис. S4 ). Наши данные показывают, что Kpn в желудочно-кишечном тракте ведет себя таким образом, чтобы не вызывать острого воспалительного ответа, и носительство считается бессимптомным явлением.

    Роль основных факторов вирулентности Kpn , включая его капсульный полисахарид (CPS), фимбрии 1 типа и другие, была тщательно изучена как в условиях in vitro, , так и in vivo (4). Однако данные о потребности Kpn CPS при колонизации ЖКТ противоречивы (41, 42). Поскольку эти исследования проводились на мышах, получавших антибиотики, возможно, что точная роль бактериальных факторов, вероятно, замаскирована.Здесь, используя нашу модель, мы окончательно показываем, что CPS Kpn является важным компонентом, необходимым для эффективной колонизации как верхнего (ротоглотка), так и нижнего (кишечника) тракта GI. Роль капсулы, возможно, относится к защите от опосредованного хозяином клиренса и взаимодействия со слизью (42, 55, 56).

    Мы также проверили требования к фимбриям Kpn типа 1 при колонизации GI. Несмотря на то, что фимбрии 1 типа имеют решающее значение для колонизации мочевыводящих путей, они, по-видимому, не нужны для колонизации ЖКТ (31).Однако для некоторых патогенных изолятов E. coli необходимы фимбрии 1 типа для колонизации (57, 58). Кроме того, недавняя работа Юнга и др. . с использованием мышей, получавших антибиотики, наблюдали дефект в колонизации ЖКТ мутантом Kpn fimD , в котором отсутствует компонент-носитель, который облегчает сборку и возможное перемещение пилуса через внешнюю мембрану (53). Однако в нашей модели мы наблюдали только небольшое снижение медианного выделения у мышей, инфицированных изогенным мутантом fimH , по сравнению со штаммом WT, что позволяет предположить, что экспрессия фимбрий типа 1 изолята KPPR1S не обязательна для колонизации ЖКТ.Этот результат о том, что фимбрии типа 1 изолята KPPR1S не вносят вклад в колонизацию ЖКТ, не был неожиданным, поскольку мы не наблюдали его экспрессии в тестируемых условиях (данные не показаны). Однако фимбрии типа 1 могут играть роль в колонизации GI для изолятов, которые действительно экспрессируют эту структуру.

    Наша модель также позволяет нам впервые понять динамику передачи Klebsiella pneumoniae . Мы наблюдали события передачи между Kpn -инфицированными и контактными мышами, предполагая, что выделение Kpn в этой модели достаточно велико для передачи, хотя и с более низкой частотой.Мы также наблюдали, что контактные мыши колонизировали с меньшей плотностью по сравнению с индексными мышами, возможно, из-за сниженной дозы Kpn в фекальных гранулах. Таким образом, наши данные основаны на эпидемиологических исследованиях, которые предполагают 5-25% переносимости в естественной среде (19, 59). Однако лечение инфицированных или контактировавших мышей антибиотиками привело к высокой частоте передачи вируса от хозяина к хозяину. Однократная доза лечения антибиотиками выявила фенотип суппершеддера у основного хозяина, который мог передаваться> 90% неинфицированных мышей.Предполагается, что 80% инфекций происходят из-за передачи 20% инфицированных людей неинфицированным хозяевам (известное как правило 80/20) (60). Такие люди называются супершеддерами или суперпредседателями. Однако мы не смогли наблюдать фенотип супершеддера Kpn без нарушения микробиоты хозяина, предполагая, что в нашей модели на животных динамика передачи Kpn не соответствует правилу 80 // 20. Многочисленные исследования кишечных патогенов показывают, что лечение антибиотиками вызывает дисбактериоз желудочно-кишечного тракта, снижает устойчивость к колонизации устойчивой резидентной микробиотой и способствует распространению патогенов (25, 26).Наш анализ 16S показывает, что фенотип супершеддера на основе антибиотиков коррелирует со снижением микробного разнообразия. В отличие от фенотипа супершеддер Salmonella серовара Typhimurium и Clostridium difficile (25, 26), фенотип супершеддера Kpn длится более короткое время после однократного лечения антибиотиком. Тем не менее, Kpn инфицированных мышей, которые постоянно получали антибиотики, выделялись на супершеддерных уровнях, и это состояние, по нашему мнению, часто встречается в больничных условиях.Наши данные показывают, что развитие фенотипа супершеддера является основным фактором передачи инфекции от хозяина к хозяину в больнице. Частота передачи K. pneumoniae не была установлена ​​в условиях больницы и может быть выше или ниже, чем частота, определенная в нашей мышиной модели. Мы полагаем, что среда с высоким уровнем использования антибиотиков увеличивает вероятность вспышек Kpn . Поэтому за пациентами, принимающими антибиотики, следует тщательно наблюдать, чтобы определить, колонизированы ли они К.пневмония .

    В заключение мы описали модель, которая будет полезна для понимания сложных взаимодействий между K. pneumoniae и иммунной системой хозяина и кишечной микробиотой. Доступность массива помеченных мутантных библиотек Kpn (32) и нескольких аннотированных геномов Kpn должна позволить провести исследования по выявлению бактериальных факторов, которые способствуют колонизации и передаче Kpn . Поскольку большинство внутрибольничных инфекций Kpn возникают в результате колонизации желудочно-кишечного тракта и фекально-орального пути передачи (20, 29), понимание биологии колонизации желудочно-кишечного тракта и фекально-оральной передачи Kpn было бы полезным, поскольку оно могло бы служить в качестве идеальная точка вмешательства.

    Дополнительные рисунки

    Рисунок S1.

    (A.) Обработка мышей, инфицированных K. pneumoniae , одним PBS (200 мкл) не вызывает фенотипа суперседдера. (B.) Обработка стрептомицина сульфатом (5 мг / 200 мкл) запускает фенотип супершеддера (> 10 8 КОЕ / грамм фекалий) у мышей, инфицированных Klebsiella pneumoniae . Вторая обработка сульфатом стрептомицина (5 мг / 200 мкл) после того, как мыши вернулись к уменьшенному выделению Kpn , вызывает второй фенотип супершеддера, который также является временным.

    Рисунок S2.

    Плотность колонизации в желудочно-кишечном тракте (подвздошная кишка, слепая кишка и толстая кишка) для изолята WT и мутанта с дефицитом изогенной капсулы ( ΔmanC ) определяли через 15 дней после инфицирования с показанными средними значениями. Предел обнаружения составил 10 2 КОЕ / грамм ткани. Различия в колонизации ЖКТ определяли с помощью теста Краскела-Уоллиса. ***, р < 0 . 001 .

    Рисунок S3.

    (A.) Лечение антибиотиками приводит к развитию фенотипа супершеддер у индексных (инфицированных) мышей и высокой скорости передачи.Индексным мышам давали ампициллин (1 г / литр) в питьевой воде за день до пероральной инокуляции изолятом Kpn MKP103. За день до того, как указательную мышь поместили в клетку с контактными мышами (n = 4), им также давали ампициллин (1 г / литр) с питьевой водой. Контактные мыши быстро колонизировались изолятом MKP103, и как индексные, так и контактные мыши демонстрировали фенотип супершеддер (> 10 8 КОЕ / грамм фекалий). Здесь показаны два независимых исследования передачи. (B.) Данные по выделению фекалий, собранные у мышей, которым вводили 10 6 КОЕ KPPR1S, помещенных в метаболическую клетку для уменьшения копрофагии, и наблюдались в течение 13 дней после инфицирования. Показаны медианные значения, где каждая точка представляет одну мышь в данный день. Предел обнаружения (L.O.D) составил 10 2 КОЕ / грамм кала.

    Рисунок S4.

    Колонизация Klebsiella pneumoniae показывает нормальную слизистую толстой кишки. Здесь представлены швейцарские рулоны слизистой оболочки толстой кишки, окрашенные гематоксилином и окрашенные эозином. (A.) Мышам вводили только PBS и готовили ткань через 7 дней после обработки. (B.) Ткань толстой кишки мышей, полученная через 7 дней после ежедневной обработки 3% DSS. Здесь подробно показано изъязвление (длинные стрелки) слизистой оболочки с воспалением, расширяющим подслизистую оболочку (*), а также потерю и фрагментацию отдельных мышечных клеток (короткие стрелки). (C.) Мышей, инфицированных KPPR1S, и ткань подготовили через 7 дней после заражения. (D.) Мышам, инфицированным KPPR1S, вводили однократную дозу стрептомицина (5 мг / 200 мкл) для запуска фенотипа супершеддера и готовили ткань через два дня после лечения антибиотиками.Эпителий толстой кишки мышей, инфицированных KPPR1S и его фенотипом супершеддер, кажется нормальным, и по морфологии сходен с контрольным PBS.

    Таблица S1.

    Список видов бактерий, идентифицированных в фекалиях мышей с помощью анализа 16s рРНК Штаммы, использованные в данном исследовании

    Благодарности

    Мы хотели бы поблагодарить доктора наук. Майкл Бахман (Мичиганский университет), Алан Хаузер (Северо-Западный университет), Вирджиния Миллер (UNC Chapel Hill), Томас Руссо (Университет Буффало-SUNY) и Джеффри Н.Weiser (Медицинская школа Нью-Йоркского университета) за штаммы, использованные в этом исследовании. Мы также хотели бы поблагодарить докторов наук. Филиппу Эрнандесу (Бостонский университет), Вирджинии Миллер, Кимберли Уокер (UNC Chapel Hill), Джеффри Н. Вейзеру и Тони Зангари (Медицинский факультет Нью-Йоркского университета) за плодотворные обсуждения относительно создания модели и рукописи.

    Это исследование финансировалось стартапом, предоставленным Баптистским медицинским центром Уэйк Форест компании M.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *